Mutagenetix > Incidental Mutation

Incidental Mutation 'R9508:Tbx18'

717942

Institutional Source

Beutler Lab

Gene Symbol

Tbx18

Ensembl Gene

ENSMUSG00000032419

Gene Name

T-box18

Synonyms

2810012F10Rik, 2810404D13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87584853-87613313 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87587926 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 397 (S397F)

Ref Sequence

ENSEMBL: ENSMUSP00000034991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034991]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034991
AA Change: S397F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: S397F

Domain	Start	End	E-Value	Type
low complexity region	30	41	N/A	INTRINSIC
low complexity region	67	87	N/A	INTRINSIC
low complexity region	113	132	N/A	INTRINSIC
TBOX	144	341	8.7e-127	SMART
low complexity region	461	476	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	G	A	13: 119,617,484 (GRCm39)	V536I		Het
Adam18	A	G	8: 25,143,778 (GRCm39)	I187T	possibly damaging	Het
Adam24	A	G	8: 41,132,941 (GRCm39)	I136M	probably benign	Het
B3galt2	A	T	1: 143,522,280 (GRCm39)	I139F	possibly damaging	Het
Cacna1i	C	T	15: 80,279,372 (GRCm39)	P2038S	probably benign	Het
Cbll1	A	T	12: 31,544,685 (GRCm39)	I26N	probably damaging	Het
Cldn1	A	T	16: 26,179,619 (GRCm39)	Y149*	probably null	Het
Cnot11	T	C	1: 39,581,575 (GRCm39)	V372A	probably damaging	Het
Cnot2	A	G	10: 116,329,616 (GRCm39)	L458P	probably damaging	Het
Cnot4	T	C	6: 35,045,554 (GRCm39)	E219G		Het
Col8a1	T	G	16: 57,448,947 (GRCm39)	I188L	unknown	Het
Daam2	T	C	17: 49,765,618 (GRCm39)	K1095R	probably damaging	Het
Dnah9	T	C	11: 65,725,089 (GRCm39)	T4355A	probably damaging	Het
Dsg4	A	G	18: 20,604,070 (GRCm39)	I846V	probably damaging	Het
Ehd4	C	T	2: 119,921,966 (GRCm39)	G430E	probably damaging	Het
Fanci	T	C	7: 79,083,033 (GRCm39)	Y670H	possibly damaging	Het
Galnt10	T	A	11: 57,673,040 (GRCm39)	N465K	possibly damaging	Het
Glipr1l1	A	G	10: 111,912,015 (GRCm39)	N183S	probably damaging	Het
Gnl1	T	C	17: 36,299,625 (GRCm39)	Y599H	possibly damaging	Het
Gpr26	T	C	7: 131,585,830 (GRCm39)	S267P	probably benign	Het
Grk2	A	T	19: 4,341,636 (GRCm39)	N179K	probably damaging	Het
Igf2bp2	T	A	16: 21,898,845 (GRCm39)	M255L	probably benign	Het
Ighv2-6	T	C	12: 113,680,430 (GRCm39)	I70M	probably benign	Het
Igkv4-74	T	A	6: 69,161,942 (GRCm39)	N76Y	probably damaging	Het
Il11ra1	T	C	4: 41,767,527 (GRCm39)	V293A	probably damaging	Het
Itpr3	G	A	17: 27,337,651 (GRCm39)		probably benign	Het
Kank2	A	T	9: 21,687,076 (GRCm39)	L582Q	probably damaging	Het
Kmt2b	T	C	7: 30,269,259 (GRCm39)	T2554A	probably damaging	Het
Mecom	T	A	3: 30,010,621 (GRCm39)	Y619F	probably benign	Het
Mknk1	A	G	4: 115,732,579 (GRCm39)	N269S	probably benign	Het
Mpp2	T	A	11: 101,951,692 (GRCm39)	E435D	probably damaging	Het
Nicn1	C	T	9: 108,171,708 (GRCm39)	R163C	possibly damaging	Het
Or2f2	A	G	6: 42,767,928 (GRCm39)	*318W	probably null	Het
Or5g9	A	G	2: 85,552,165 (GRCm39)	R139G	possibly damaging	Het
Or7a41	A	T	10: 78,870,933 (GRCm39)	Q101L	probably damaging	Het
P3h3	A	G	6: 124,830,012 (GRCm39)		probably null	Het
Paqr5	C	T	9: 61,880,079 (GRCm39)	V72M	probably benign	Het
Pilrb2	G	A	5: 137,869,261 (GRCm39)	T113I	probably damaging	Het
Pitpnm3	T	C	11: 72,003,121 (GRCm39)	E63G	probably damaging	Het
Ppp4r4	G	A	12: 103,542,561 (GRCm39)	V108M	possibly damaging	Het
Ptprf	G	T	4: 118,126,776 (GRCm39)	S46*	probably null	Het
Rab2a	T	C	4: 8,582,447 (GRCm39)	L143P		Het
Rassf7	C	T	7: 140,796,924 (GRCm39)	R46*	probably null	Het
Sec23a	T	C	12: 59,036,185 (GRCm39)	D393G	probably benign	Het
Semp2l2b	A	G	10: 21,942,816 (GRCm39)	V388A	probably damaging	Het
Serpinb9f	T	A	13: 33,518,515 (GRCm39)	F338L	probably benign	Het
Spg7	T	C	8: 123,800,623 (GRCm39)	V66A	probably damaging	Het
Sult2a4	C	T	7: 13,723,437 (GRCm39)	R27H	probably benign	Het
Sumo2	A	C	11: 115,414,538 (GRCm39)	Y95D	possibly damaging	Het
Ticam2	G	C	18: 46,693,748 (GRCm39)	P113R	probably damaging	Het
Timeless	A	G	10: 128,076,096 (GRCm39)	S63G	probably benign	Het
Tinag	C	T	9: 76,912,981 (GRCm39)	C276Y	probably damaging	Het
Tmem143	A	T	7: 45,565,630 (GRCm39)	K364*	probably null	Het
Tmem160	A	G	7: 16,186,840 (GRCm39)		probably benign	Het
Tmod4	G	C	3: 95,034,713 (GRCm39)	E154Q	probably benign	Het
Trpv1	G	T	11: 73,145,090 (GRCm39)	K725N		Het
Ttn	G	T	2: 76,715,978 (GRCm39)	A7767D	unknown	Het
Tubd1	T	A	11: 86,448,640 (GRCm39)	Y318N	probably damaging	Het
Ufd1	T	A	16: 18,643,802 (GRCm39)	M187K	possibly damaging	Het
Unc5c	A	G	3: 141,494,736 (GRCm39)	N424D	possibly damaging	Het
Usp19	C	T	9: 108,371,608 (GRCm39)	S329L	probably damaging	Het
Vps16	T	A	2: 130,284,361 (GRCm39)	I704N	possibly damaging	Het
Vwf	A	T	6: 125,532,471 (GRCm39)	I72F		Het
Ypel4	T	C	2: 84,567,304 (GRCm39)	S46P	probably damaging	Het
Zcchc8	A	C	5: 123,842,584 (GRCm39)		probably null	Het

Other mutations in Tbx18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Tbx18	APN	9	87,587,676 (GRCm39)	missense	possibly damaging	0.90
IGL00832:Tbx18	APN	9	87,587,714 (GRCm39)	missense	probably damaging	1.00
IGL01287:Tbx18	APN	9	87,606,384 (GRCm39)	missense	probably damaging	0.98
IGL01406:Tbx18	APN	9	87,595,596 (GRCm39)	missense	probably damaging	0.99
IGL01587:Tbx18	APN	9	87,606,461 (GRCm39)	missense	probably damaging	0.99
IGL01898:Tbx18	APN	9	87,589,912 (GRCm39)	missense	possibly damaging	0.92
IGL02624:Tbx18	APN	9	87,609,459 (GRCm39)	missense	probably damaging	1.00
IGL03057:Tbx18	APN	9	87,612,882 (GRCm39)	missense	probably damaging	0.99
IGL03252:Tbx18	APN	9	87,587,633 (GRCm39)	missense	probably damaging	1.00
R0126:Tbx18	UTSW	9	87,611,706 (GRCm39)	missense	possibly damaging	0.50
R0243:Tbx18	UTSW	9	87,597,569 (GRCm39)	splice site	probably benign
R0374:Tbx18	UTSW	9	87,606,408 (GRCm39)	missense	probably damaging	0.97
R0666:Tbx18	UTSW	9	87,606,462 (GRCm39)	missense	probably benign	0.13
R2141:Tbx18	UTSW	9	87,597,706 (GRCm39)	missense	probably damaging	0.99
R2183:Tbx18	UTSW	9	87,587,789 (GRCm39)	missense	probably damaging	0.98
R2233:Tbx18	UTSW	9	87,606,403 (GRCm39)	missense	probably damaging	1.00
R2234:Tbx18	UTSW	9	87,606,403 (GRCm39)	missense	probably damaging	1.00
R2235:Tbx18	UTSW	9	87,606,403 (GRCm39)	missense	probably damaging	1.00
R3835:Tbx18	UTSW	9	87,611,689 (GRCm39)	missense	probably benign
R4214:Tbx18	UTSW	9	87,606,518 (GRCm39)	missense	probably damaging	1.00
R4606:Tbx18	UTSW	9	87,612,822 (GRCm39)	missense	possibly damaging	0.84
R4834:Tbx18	UTSW	9	87,609,502 (GRCm39)	missense	possibly damaging	0.48
R5112:Tbx18	UTSW	9	87,597,740 (GRCm39)	missense	probably damaging	1.00
R5887:Tbx18	UTSW	9	87,595,566 (GRCm39)	missense	possibly damaging	0.58
R6628:Tbx18	UTSW	9	87,597,588 (GRCm39)	nonsense	probably null
R6659:Tbx18	UTSW	9	87,589,864 (GRCm39)	missense	probably damaging	1.00
R7001:Tbx18	UTSW	9	87,609,457 (GRCm39)	missense	probably damaging	1.00
R7057:Tbx18	UTSW	9	87,587,317 (GRCm39)	missense	possibly damaging	0.94
R7167:Tbx18	UTSW	9	87,589,883 (GRCm39)	missense	probably damaging	1.00
R7368:Tbx18	UTSW	9	87,612,750 (GRCm39)	missense	probably benign
R8147:Tbx18	UTSW	9	87,606,411 (GRCm39)	missense	probably damaging	0.97
R8993:Tbx18	UTSW	9	87,612,770 (GRCm39)	missense	probably benign	0.00
R9263:Tbx18	UTSW	9	87,611,521 (GRCm39)	missense	probably damaging	0.97
R9291:Tbx18	UTSW	9	87,611,535 (GRCm39)	missense	probably damaging	1.00
R9396:Tbx18	UTSW	9	87,609,432 (GRCm39)	missense	probably damaging	1.00
R9420:Tbx18	UTSW	9	87,612,675 (GRCm39)	missense	probably benign
R9577:Tbx18	UTSW	9	87,611,512 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGCTCTGGTTGGTAAGCC -3'
(R):5'- AAGCTAAGCCACTTTTCACCTTTG -3'

Sequencing Primer
(F):5'- CTGCTGTAGGTCTCTGCCAAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2022-07-18