Incidental Mutation 'R9508:Glipr1l1'
ID 717947
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene Name GLI pathogenesis-related 1 like 1
Synonyms 1700011E04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9508 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 112060189-112078510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112076110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 183 (N183S)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073617]
AlphaFold Q9DAG6
Predicted Effect probably damaging
Transcript: ENSMUST00000073617
AA Change: N183S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: N183S

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G A 13: 119,480,948 V536I Het
4930444G20Rik A G 10: 22,066,917 V388A probably damaging Het
Adam18 A G 8: 24,653,762 I187T possibly damaging Het
Adam24 A G 8: 40,679,902 I136M probably benign Het
B3galt2 A T 1: 143,646,542 I139F possibly damaging Het
Cacna1i C T 15: 80,395,171 P2038S probably benign Het
Cbll1 A T 12: 31,494,686 I26N probably damaging Het
Cldn1 A T 16: 26,360,869 Y149* probably null Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cnot2 A G 10: 116,493,711 L458P probably damaging Het
Cnot4 T C 6: 35,068,619 E219G Het
Col8a1 T G 16: 57,628,584 I188L unknown Het
Daam2 T C 17: 49,458,590 K1095R probably damaging Het
Dnah9 T C 11: 65,834,263 T4355A probably damaging Het
Dsg4 A G 18: 20,471,013 I846V probably damaging Het
Ehd4 C T 2: 120,091,485 G430E probably damaging Het
Fanci T C 7: 79,433,285 Y670H possibly damaging Het
Galnt10 T A 11: 57,782,214 N465K possibly damaging Het
Gnl1 T C 17: 35,988,733 Y599H possibly damaging Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Grk2 A T 19: 4,291,608 N179K probably damaging Het
Igf2bp2 T A 16: 22,080,095 M255L probably benign Het
Ighv2-6 T C 12: 113,716,810 I70M probably benign Het
Igkv4-74 T A 6: 69,184,958 N76Y probably damaging Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank2 A T 9: 21,775,780 L582Q probably damaging Het
Kmt2b T C 7: 30,569,834 T2554A probably damaging Het
Mecom T A 3: 29,956,472 Y619F probably benign Het
Mknk1 A G 4: 115,875,382 N269S probably benign Het
Mpp2 T A 11: 102,060,866 E435D probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr1009 A G 2: 85,721,821 R139G possibly damaging Het
Olfr452 A G 6: 42,790,994 *318W probably null Het
Olfr57 A T 10: 79,035,099 Q101L probably damaging Het
P3h3 A G 6: 124,853,049 probably null Het
Paqr5 C T 9: 61,972,797 V72M probably benign Het
Pilrb2 G A 5: 137,870,999 T113I probably damaging Het
Pitpnm3 T C 11: 72,112,295 E63G probably damaging Het
Ppp4r4 G A 12: 103,576,302 V108M possibly damaging Het
Ptprf G T 4: 118,269,579 S46* probably null Het
Rab2a T C 4: 8,582,447 L143P Het
Rassf7 C T 7: 141,217,011 R46* probably null Het
Sec23a T C 12: 58,989,399 D393G probably benign Het
Serpinb9f T A 13: 33,334,532 F338L probably benign Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Sult2a4 C T 7: 13,989,512 R27H probably benign Het
Sumo2 A C 11: 115,523,712 Y95D possibly damaging Het
Tbx18 G A 9: 87,705,873 S397F probably damaging Het
Ticam2 G C 18: 46,560,681 P113R probably damaging Het
Timeless A G 10: 128,240,227 S63G probably benign Het
Tinag C T 9: 77,005,699 C276Y probably damaging Het
Tmem143 A T 7: 45,916,206 K364* probably null Het
Tmem160 A G 7: 16,452,915 probably benign Het
Tmod4 G C 3: 95,127,402 E154Q probably benign Het
Trpv1 G T 11: 73,254,264 K725N Het
Ttn G T 2: 76,885,634 A7767D unknown Het
Tubd1 T A 11: 86,557,814 Y318N probably damaging Het
Ufd1 T A 16: 18,825,052 M187K possibly damaging Het
Unc5c A G 3: 141,788,975 N424D possibly damaging Het
Usp19 C T 9: 108,494,409 S329L probably damaging Het
Vps16 T A 2: 130,442,441 I704N possibly damaging Het
Vwf A T 6: 125,555,508 I72F Het
Ypel4 T C 2: 84,736,960 S46P probably damaging Het
Zcchc8 A C 5: 123,704,521 probably null Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 112078381 missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 112072279 missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 112076169 missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 112060319 missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 112072236 splice site probably benign
P0031:Glipr1l1 UTSW 10 112060387 missense probably benign
R0987:Glipr1l1 UTSW 10 112078435 missense probably benign
R0992:Glipr1l1 UTSW 10 112062325 missense probably benign
R2136:Glipr1l1 UTSW 10 112060476 missense probably damaging 1.00
R2248:Glipr1l1 UTSW 10 112062287 missense probably benign 0.09
R4297:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4298:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 112062412 missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 112078374 missense probably benign 0.00
R5552:Glipr1l1 UTSW 10 112062338 missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 112078403 missense possibly damaging 0.90
R6061:Glipr1l1 UTSW 10 112076170 missense probably benign 0.32
R6237:Glipr1l1 UTSW 10 112060427 nonsense probably null
R6519:Glipr1l1 UTSW 10 112062248 missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 112062434 critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 112060395 missense probably benign 0.00
R8171:Glipr1l1 UTSW 10 112078384 missense probably benign 0.01
R9182:Glipr1l1 UTSW 10 112076151 missense probably damaging 1.00
R9319:Glipr1l1 UTSW 10 112062217 missense probably damaging 1.00
X0023:Glipr1l1 UTSW 10 112078439 missense probably damaging 0.98
Z1177:Glipr1l1 UTSW 10 112078390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAAGATGTTTTAATGCTGTCTTAGC -3'
(R):5'- AGCAGACTAGATCACAGTTGTATT -3'

Sequencing Primer
(F):5'- CTGTCTTAGCATATAGGAAACGAGTC -3'
(R):5'- GTTCTAATAGAAGCAAGCAAGTCATC -3'
Posted On 2022-07-18