Incidental Mutation 'R9509:Zfp352'
ID 717989
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9509 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 90218820-90225702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90224706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 361 (E361G)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect probably damaging
Transcript: ENSMUST00000080541
AA Change: E361G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: E361G

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107129
AA Change: E361G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: E361G

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
2310035C23Rik A G 1: 105,686,979 E216G probably damaging Het
4932415D10Rik A T 10: 82,296,395 N260K probably benign Het
5830411N06Rik T A 7: 140,299,731 Y1093* probably null Het
Acan C T 7: 79,091,020 P378L probably damaging Het
Akap6 A G 12: 53,142,238 D2145G probably damaging Het
Akap9 A T 5: 4,046,349 D2408V probably benign Het
Apol10a C A 15: 77,488,768 Y201* probably null Het
Arhgef4 T C 1: 34,723,691 I676T unknown Het
Capn13 T C 17: 73,337,451 H361R probably benign Het
Ccdc88a G A 11: 29,464,143 V894I probably benign Het
Chd4 T A 6: 125,122,522 L1655Q possibly damaging Het
Chil1 G A 1: 134,188,675 E307K probably damaging Het
Dhfr T A 13: 92,368,231 I139N probably damaging Het
Dock8 A G 19: 25,095,621 S422G probably benign Het
Dspp C A 5: 104,177,791 D673E unknown Het
Dst G T 1: 33,908,384 W38L possibly damaging Het
Dynlt1b A T 17: 6,435,016 E26D probably benign Het
Dysf A T 6: 84,210,797 Y2059F probably damaging Het
Efcab5 G A 11: 77,104,151 S1198F possibly damaging Het
Erp44 T C 4: 48,208,750 I237V probably benign Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fat2 A G 11: 55,309,887 V787A possibly damaging Het
Fbn2 C G 18: 58,114,478 G448A probably benign Het
Fbxw21 A G 9: 109,148,149 V164A possibly damaging Het
Gabpa G A 16: 84,852,507 V201I possibly damaging Het
Gm12253 G A 11: 58,439,945 V177M probably benign Het
Il2rb C A 15: 78,490,216 W84L probably damaging Het
Kank4 T A 4: 98,774,867 T695S possibly damaging Het
Klhl29 T C 12: 5,140,629 Q122R probably damaging Het
L3mbtl1 A G 2: 162,967,383 E670G probably damaging Het
Lifr A G 15: 7,159,474 Y112C probably damaging Het
Lins1 C T 7: 66,708,371 Q85* probably null Het
Lpcat1 T A 13: 73,494,832 V175E probably damaging Het
Mdm1 T C 10: 118,146,825 S122P probably damaging Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Mylk4 T C 13: 32,720,560 N197S probably benign Het
Neurl4 T A 11: 69,902,145 L83* probably null Het
Nlrc3 T C 16: 3,964,816 D259G probably damaging Het
Nsf A T 11: 103,863,248 D487E probably benign Het
Olfr138 A G 17: 38,275,390 I206M probably benign Het
Olfr1385 A G 11: 49,494,649 I39V probably benign Het
Olfr469 T A 7: 107,823,233 T79S probably benign Het
Palb2 T A 7: 122,128,176 K157M probably damaging Het
Pbrm1 T C 14: 31,084,957 S1114P probably damaging Het
Pdia6 T A 12: 17,280,988 M364K probably damaging Het
Pf4 G T 5: 90,773,189 G83W probably damaging Het
Pibf1 T C 14: 99,101,285 M79T probably benign Het
Polr3b T G 10: 84,631,786 Y77D probably damaging Het
Pomt2 T A 12: 87,138,028 H208L possibly damaging Het
Pprc1 A T 19: 46,063,399 K456M unknown Het
Rasgef1a A T 6: 118,084,430 K119* probably null Het
Rbbp6 T A 7: 122,998,568 Y701N unknown Het
Reln A T 5: 22,344,200 V70E possibly damaging Het
Rgs17 T C 10: 5,862,576 N41S probably benign Het
Rhbdf1 A T 11: 32,215,055 I106N possibly damaging Het
Robo1 T A 16: 72,962,279 N393K probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scnn1a A T 6: 125,342,641 D495V probably damaging Het
Serpinf2 G A 11: 75,438,069 P45L probably benign Het
Setdb1 A C 3: 95,354,589 I122S possibly damaging Het
Slc4a9 A T 18: 36,535,390 M701L probably damaging Het
Supv3l1 T C 10: 62,429,632 T710A probably benign Het
Syne1 A T 10: 5,348,927 probably null Het
Tenm3 A T 8: 48,313,257 Y743* probably null Het
Tgm2 A T 2: 158,127,290 Y388* probably null Het
Tmem55a T A 4: 14,892,485 C116* probably null Het
Tor3a A G 1: 156,655,929 S308P possibly damaging Het
Trim12a T C 7: 104,304,344 K187E probably benign Het
Trpc1 C T 9: 95,743,196 probably null Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ush2a T A 1: 188,916,243 Y4682N probably damaging Het
Vldlr A G 19: 27,244,287 N684S probably benign Het
Vmn2r72 T A 7: 85,754,867 I39L probably benign Het
Vps13b A T 15: 35,841,311 M2496L possibly damaging Het
Zbtb5 C T 4: 44,994,332 V351M probably damaging Het
Zeb2 T A 2: 44,997,864 T394S possibly damaging Het
Zfp54 C A 17: 21,434,367 Y374* probably null Het
Zfp869 C A 8: 69,706,946 G326W probably damaging Het
Zfyve28 C T 5: 34,197,548 A806T probably benign Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90224154 missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90224130 missense probably benign 0.02
IGL03156:Zfp352 APN 4 90224087 missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90224702 missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90223757 missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90224346 missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90224285 missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90225009 missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90224690 missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90223919 missense probably benign
R1034:Zfp352 UTSW 4 90224156 missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90223809 missense probably benign 0.23
R2016:Zfp352 UTSW 4 90225171 missense probably benign 0.42
R2064:Zfp352 UTSW 4 90225120 missense probably benign 0.08
R2308:Zfp352 UTSW 4 90225243 missense probably benign 0.00
R3552:Zfp352 UTSW 4 90225102 missense probably benign 0.33
R3794:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90225024 missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90223834 missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90225164 missense probably benign 0.00
R4590:Zfp352 UTSW 4 90224535 missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4617:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4618:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4741:Zfp352 UTSW 4 90224940 missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90224304 missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R4973:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R5167:Zfp352 UTSW 4 90224216 missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90224460 missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90225104 missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90225070 missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90225200 missense probably benign 0.33
R6819:Zfp352 UTSW 4 90224699 missense probably benign
R7072:Zfp352 UTSW 4 90224424 missense probably benign 0.00
R7099:Zfp352 UTSW 4 90224880 missense probably benign 0.00
R7569:Zfp352 UTSW 4 90223659 missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90224777 missense probably benign 0.13
R7705:Zfp352 UTSW 4 90225275 missense possibly damaging 0.94
R8424:Zfp352 UTSW 4 90224243 missense possibly damaging 0.87
R9180:Zfp352 UTSW 4 90224881 missense probably benign 0.38
R9378:Zfp352 UTSW 4 90224338 missense probably benign 0.13
R9623:Zfp352 UTSW 4 90224891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTACAGATGTGACCAGG -3'
(R):5'- TCTCTGGACTAAACTGGAAGCCG -3'

Sequencing Primer
(F):5'- GCTACAGATGTGACCAGGATTTG -3'
(R):5'- ACTGGAAGCCGAAGAGTTTTTC -3'
Posted On 2022-07-18