Incidental Mutation 'R9509:Dock8'
ID 718052
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9509 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24999529-25202432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25095621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 422 (S422G)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: S422G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: S422G

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
2310035C23Rik A G 1: 105,686,979 E216G probably damaging Het
4932415D10Rik A T 10: 82,296,395 N260K probably benign Het
5830411N06Rik T A 7: 140,299,731 Y1093* probably null Het
Acan C T 7: 79,091,020 P378L probably damaging Het
Akap6 A G 12: 53,142,238 D2145G probably damaging Het
Akap9 A T 5: 4,046,349 D2408V probably benign Het
Apol10a C A 15: 77,488,768 Y201* probably null Het
Arhgef4 T C 1: 34,723,691 I676T unknown Het
Capn13 T C 17: 73,337,451 H361R probably benign Het
Ccdc88a G A 11: 29,464,143 V894I probably benign Het
Chd4 T A 6: 125,122,522 L1655Q possibly damaging Het
Chil1 G A 1: 134,188,675 E307K probably damaging Het
Dhfr T A 13: 92,368,231 I139N probably damaging Het
Dspp C A 5: 104,177,791 D673E unknown Het
Dst G T 1: 33,908,384 W38L possibly damaging Het
Dynlt1b A T 17: 6,435,016 E26D probably benign Het
Dysf A T 6: 84,210,797 Y2059F probably damaging Het
Efcab5 G A 11: 77,104,151 S1198F possibly damaging Het
Erp44 T C 4: 48,208,750 I237V probably benign Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fat2 A G 11: 55,309,887 V787A possibly damaging Het
Fbn2 C G 18: 58,114,478 G448A probably benign Het
Fbxw21 A G 9: 109,148,149 V164A possibly damaging Het
Gabpa G A 16: 84,852,507 V201I possibly damaging Het
Gm12253 G A 11: 58,439,945 V177M probably benign Het
Il2rb C A 15: 78,490,216 W84L probably damaging Het
Kank4 T A 4: 98,774,867 T695S possibly damaging Het
Klhl29 T C 12: 5,140,629 Q122R probably damaging Het
L3mbtl1 A G 2: 162,967,383 E670G probably damaging Het
Lifr A G 15: 7,159,474 Y112C probably damaging Het
Lins1 C T 7: 66,708,371 Q85* probably null Het
Lpcat1 T A 13: 73,494,832 V175E probably damaging Het
Mdm1 T C 10: 118,146,825 S122P probably damaging Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Mylk4 T C 13: 32,720,560 N197S probably benign Het
Neurl4 T A 11: 69,902,145 L83* probably null Het
Nlrc3 T C 16: 3,964,816 D259G probably damaging Het
Nsf A T 11: 103,863,248 D487E probably benign Het
Olfr138 A G 17: 38,275,390 I206M probably benign Het
Olfr1385 A G 11: 49,494,649 I39V probably benign Het
Olfr469 T A 7: 107,823,233 T79S probably benign Het
Palb2 T A 7: 122,128,176 K157M probably damaging Het
Pbrm1 T C 14: 31,084,957 S1114P probably damaging Het
Pdia6 T A 12: 17,280,988 M364K probably damaging Het
Pf4 G T 5: 90,773,189 G83W probably damaging Het
Pibf1 T C 14: 99,101,285 M79T probably benign Het
Polr3b T G 10: 84,631,786 Y77D probably damaging Het
Pomt2 T A 12: 87,138,028 H208L possibly damaging Het
Pprc1 A T 19: 46,063,399 K456M unknown Het
Rasgef1a A T 6: 118,084,430 K119* probably null Het
Rbbp6 T A 7: 122,998,568 Y701N unknown Het
Reln A T 5: 22,344,200 V70E possibly damaging Het
Rgs17 T C 10: 5,862,576 N41S probably benign Het
Rhbdf1 A T 11: 32,215,055 I106N possibly damaging Het
Robo1 T A 16: 72,962,279 N393K probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scnn1a A T 6: 125,342,641 D495V probably damaging Het
Serpinf2 G A 11: 75,438,069 P45L probably benign Het
Setdb1 A C 3: 95,354,589 I122S possibly damaging Het
Slc4a9 A T 18: 36,535,390 M701L probably damaging Het
Supv3l1 T C 10: 62,429,632 T710A probably benign Het
Syne1 A T 10: 5,348,927 probably null Het
Tenm3 A T 8: 48,313,257 Y743* probably null Het
Tgm2 A T 2: 158,127,290 Y388* probably null Het
Tmem55a T A 4: 14,892,485 C116* probably null Het
Tor3a A G 1: 156,655,929 S308P possibly damaging Het
Trim12a T C 7: 104,304,344 K187E probably benign Het
Trpc1 C T 9: 95,743,196 probably null Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ush2a T A 1: 188,916,243 Y4682N probably damaging Het
Vldlr A G 19: 27,244,287 N684S probably benign Het
Vmn2r72 T A 7: 85,754,867 I39L probably benign Het
Vps13b A T 15: 35,841,311 M2496L possibly damaging Het
Zbtb5 C T 4: 44,994,332 V351M probably damaging Het
Zeb2 T A 2: 44,997,864 T394S possibly damaging Het
Zfp352 A G 4: 90,224,706 E361G probably damaging Het
Zfp54 C A 17: 21,434,367 Y374* probably null Het
Zfp869 C A 8: 69,706,946 G326W probably damaging Het
Zfyve28 C T 5: 34,197,548 A806T probably benign Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
Papilla UTSW 19 25078084 nonsense probably null
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
R8834:Dock8 UTSW 19 25163470 missense probably benign 0.16
R8991:Dock8 UTSW 19 25188367 missense possibly damaging 0.82
R9526:Dock8 UTSW 19 25188375 missense probably benign 0.10
R9622:Dock8 UTSW 19 25121181 missense probably null
R9634:Dock8 UTSW 19 25192221 missense probably damaging 1.00
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCCATCAGAGTAGCTACTGTCAC -3'
(R):5'- CCAAGCATGTGCAGTTTAGTCG -3'

Sequencing Primer
(F):5'- GAGTAGCTACTGTCACCCCATG -3'
(R):5'- ATGTGCAGTTTAGTCGTCTATTTATG -3'
Posted On 2022-07-18