Incidental Mutation 'R9510:Cr2'
ID 718062
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 195136811-195176716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 195158108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 509 (L509M)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: L509M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: L509M

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: L212M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: L212M

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: L509M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: L509M

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: L885M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 W6G unknown Het
Aatk A T 11: 120,010,268 C1101S probably benign Het
Ankrd61 T C 5: 143,891,504 T218A possibly damaging Het
Cacna1b T C 2: 24,650,046 E1467G probably damaging Het
Ccdc186 T C 19: 56,813,584 T34A probably benign Het
Cdc42bpb G A 12: 111,294,938 P1656S probably benign Het
Cdk13 A C 13: 17,728,162 C934W probably damaging Het
Cebpg T C 7: 35,050,655 N61S probably benign Het
Cldn13 T A 5: 134,914,989 E114V probably benign Het
Clec9a T A 6: 129,421,060 I187K possibly damaging Het
Creb3l2 C A 6: 37,334,511 G448W probably damaging Het
Csf2rb T A 15: 78,345,560 probably null Het
Cyth1 C T 11: 118,185,380 probably null Het
Dapk1 A T 13: 60,762,389 D1441V unknown Het
Dnhd1 A T 7: 105,703,682 N2681Y possibly damaging Het
Dnm1 T C 2: 32,323,727 M476V probably benign Het
Dock1 T G 7: 134,990,550 I938S probably benign Het
Duox1 G A 2: 122,329,542 V713I possibly damaging Het
Dusp16 T C 6: 134,718,263 H535R probably benign Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Fancd2os T A 6: 113,598,033 Y4F probably damaging Het
Fat4 A T 3: 38,983,737 Q3846L probably benign Het
Fbxw10 A C 11: 62,852,988 H240P probably benign Het
Fer1l5 T C 1: 36,403,581 L727P probably damaging Het
Fezf1 A C 6: 23,247,846 F77V probably benign Het
Fli1 T C 9: 32,424,197 D313G probably damaging Het
Frmd4a A G 2: 4,603,513 T731A probably benign Het
Gfy T C 7: 45,178,666 Q2R possibly damaging Het
Ggt5 T C 10: 75,609,305 V382A probably benign Het
Gm8765 A G 13: 50,702,113 T596A possibly damaging Het
Hira A G 16: 18,954,039 D867G probably damaging Het
Hmcn1 A G 1: 150,586,376 S5184P probably benign Het
Ighv1-26 A C 12: 114,788,787 F7V probably benign Het
Igkv4-81 C T 6: 68,990,812 E102K possibly damaging Het
Inmt G T 6: 55,171,005 S213Y possibly damaging Het
Ints2 T A 11: 86,244,509 M360L probably benign Het
Itih3 A G 14: 30,909,459 S827P probably benign Het
Kcnk12 C A 17: 87,746,694 R180L probably benign Het
Klhl2 T C 8: 64,749,079 N521S probably benign Het
Kmt2a A T 9: 44,823,234 F2104I unknown Het
Kndc1 G A 7: 139,930,118 S1291N probably benign Het
Mettl21a T C 1: 64,608,126 T91A probably damaging Het
Mmrn2 A G 14: 34,398,450 I426V possibly damaging Het
Mrpl2 T C 17: 46,647,514 V74A probably benign Het
Msantd4 A G 9: 4,385,007 D244G probably benign Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Ncam2 A G 16: 81,623,453 *838W probably null Het
Ncor1 CTG CTGATG 11: 62,433,616 probably benign Het
Nsf T C 11: 103,873,162 N365S probably damaging Het
Osbpl3 C T 6: 50,336,214 probably null Het
Pam C T 1: 97,898,340 probably null Het
Parn A T 16: 13,541,078 M600K probably benign Het
Pcdha11 C A 18: 37,006,479 T387N probably benign Het
Ptprt A C 2: 161,555,461 C1129G probably damaging Het
Ralgapb T A 2: 158,443,936 S645T probably damaging Het
Rara C T 11: 98,970,157 S157L probably benign Het
Rnf40 T A 7: 127,602,636 I1000N probably damaging Het
Sap25 C T 5: 137,642,232 T141I probably null Het
Scube2 C T 7: 109,831,762 G410E probably damaging Het
Sh3gl2 A G 4: 85,385,852 E264G probably benign Het
Smc4 T G 3: 69,007,329 S92A probably damaging Het
Sorcs1 C T 19: 50,678,083 R129Q probably benign Het
Spef2 T C 15: 9,713,117 R390G probably damaging Het
Speg T C 1: 75,401,124 F842S probably damaging Het
Stk17b G T 1: 53,757,739 H290N probably damaging Het
Stpg3 A T 2: 25,213,504 V191D probably benign Het
Supt6 C T 11: 78,229,464 R350H probably damaging Het
Taf1b G A 12: 24,516,948 A214T possibly damaging Het
Tet3 T C 6: 83,403,953 E411G possibly damaging Het
Tet3 T A 6: 83,404,826 probably null Het
Tg T C 15: 66,674,064 Y212H probably damaging Het
Tns3 A G 11: 8,445,702 I1234T probably damaging Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tram2 C G 1: 21,003,926 A263P possibly damaging Het
Treml1 T G 17: 48,366,743 S261A probably damaging Het
Trim34b A G 7: 104,331,296 E197G probably damaging Het
Tspan18 C T 2: 93,220,117 G54S probably damaging Het
Wdtc1 A G 4: 133,322,218 V29A probably damaging Het
Zdhhc16 T C 19: 41,940,716 Y253H probably damaging Het
Zfp366 A G 13: 99,229,366 Y345C probably damaging Het
Zfp423 T A 8: 87,783,413 D101V possibly damaging Het
Zfp462 G A 4: 55,080,735 M2450I probably benign Het
Zfp52 C T 17: 21,561,956 L689F possibly damaging Het
Zim1 G A 7: 6,687,740 Q29* probably null Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
R8773:Cr2 UTSW 1 195158605 missense probably damaging 1.00
R8849:Cr2 UTSW 1 195157239 missense probably damaging 1.00
R8896:Cr2 UTSW 1 195169273 missense possibly damaging 0.58
R8938:Cr2 UTSW 1 195171116 missense probably damaging 0.99
R9027:Cr2 UTSW 1 195151721 missense probably benign 0.08
R9045:Cr2 UTSW 1 195155372 missense possibly damaging 0.61
R9116:Cr2 UTSW 1 195158669 nonsense probably null
R9137:Cr2 UTSW 1 195168332 critical splice donor site probably null
R9476:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9497:Cr2 UTSW 1 195168435 missense probably damaging 0.99
R9752:Cr2 UTSW 1 195141267 missense probably benign 0.37
R9799:Cr2 UTSW 1 195160680 missense probably benign 0.02
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTTTGACGCAACCCAAAGTAGG -3'
(R):5'- CTATGCAGTTAATGGATGGTGC -3'

Sequencing Primer
(F):5'- CCCAAAGTAGGAATTTTGGCTCC -3'
(R):5'- CAGTTAATGGATGGTGCTGAGG -3'
Posted On 2022-07-18