Incidental Mutation 'R9510:Duox1'
ID 718069
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Name dual oxidase 1
Synonyms THOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene? Non essential (E-score: 0.000) question?
Stock # R9510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 122315672-122347972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122329542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 713 (V713I)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
AlphaFold A2AQ92
Predicted Effect possibly damaging
Transcript: ENSMUST00000099461
AA Change: V713I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: V713I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 W6G unknown Het
Aatk A T 11: 120,010,268 C1101S probably benign Het
Ankrd61 T C 5: 143,891,504 T218A possibly damaging Het
Cacna1b T C 2: 24,650,046 E1467G probably damaging Het
Ccdc186 T C 19: 56,813,584 T34A probably benign Het
Cdc42bpb G A 12: 111,294,938 P1656S probably benign Het
Cdk13 A C 13: 17,728,162 C934W probably damaging Het
Cebpg T C 7: 35,050,655 N61S probably benign Het
Cldn13 T A 5: 134,914,989 E114V probably benign Het
Clec9a T A 6: 129,421,060 I187K possibly damaging Het
Cr2 G T 1: 195,158,108 L509M probably damaging Het
Creb3l2 C A 6: 37,334,511 G448W probably damaging Het
Csf2rb T A 15: 78,345,560 probably null Het
Cyth1 C T 11: 118,185,380 probably null Het
Dapk1 A T 13: 60,762,389 D1441V unknown Het
Dnhd1 A T 7: 105,703,682 N2681Y possibly damaging Het
Dnm1 T C 2: 32,323,727 M476V probably benign Het
Dock1 T G 7: 134,990,550 I938S probably benign Het
Dusp16 T C 6: 134,718,263 H535R probably benign Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Fancd2os T A 6: 113,598,033 Y4F probably damaging Het
Fat4 A T 3: 38,983,737 Q3846L probably benign Het
Fbxw10 A C 11: 62,852,988 H240P probably benign Het
Fer1l5 T C 1: 36,403,581 L727P probably damaging Het
Fezf1 A C 6: 23,247,846 F77V probably benign Het
Fli1 T C 9: 32,424,197 D313G probably damaging Het
Frmd4a A G 2: 4,603,513 T731A probably benign Het
Gfy T C 7: 45,178,666 Q2R possibly damaging Het
Ggt5 T C 10: 75,609,305 V382A probably benign Het
Gm8765 A G 13: 50,702,113 T596A possibly damaging Het
Hira A G 16: 18,954,039 D867G probably damaging Het
Hmcn1 A G 1: 150,586,376 S5184P probably benign Het
Ighv1-26 A C 12: 114,788,787 F7V probably benign Het
Igkv4-81 C T 6: 68,990,812 E102K possibly damaging Het
Inmt G T 6: 55,171,005 S213Y possibly damaging Het
Ints2 T A 11: 86,244,509 M360L probably benign Het
Itih3 A G 14: 30,909,459 S827P probably benign Het
Kcnk12 C A 17: 87,746,694 R180L probably benign Het
Klhl2 T C 8: 64,749,079 N521S probably benign Het
Kmt2a A T 9: 44,823,234 F2104I unknown Het
Kndc1 G A 7: 139,930,118 S1291N probably benign Het
Mettl21a T C 1: 64,608,126 T91A probably damaging Het
Mmrn2 A G 14: 34,398,450 I426V possibly damaging Het
Mrpl2 T C 17: 46,647,514 V74A probably benign Het
Msantd4 A G 9: 4,385,007 D244G probably benign Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Ncam2 A G 16: 81,623,453 *838W probably null Het
Ncor1 CTG CTGATG 11: 62,433,616 probably benign Het
Nsf T C 11: 103,873,162 N365S probably damaging Het
Osbpl3 C T 6: 50,336,214 probably null Het
Pam C T 1: 97,898,340 probably null Het
Parn A T 16: 13,541,078 M600K probably benign Het
Pcdha11 C A 18: 37,006,479 T387N probably benign Het
Ptprt A C 2: 161,555,461 C1129G probably damaging Het
Ralgapb T A 2: 158,443,936 S645T probably damaging Het
Rara C T 11: 98,970,157 S157L probably benign Het
Rnf40 T A 7: 127,602,636 I1000N probably damaging Het
Sap25 C T 5: 137,642,232 T141I probably null Het
Scube2 C T 7: 109,831,762 G410E probably damaging Het
Sh3gl2 A G 4: 85,385,852 E264G probably benign Het
Smc4 T G 3: 69,007,329 S92A probably damaging Het
Sorcs1 C T 19: 50,678,083 R129Q probably benign Het
Spef2 T C 15: 9,713,117 R390G probably damaging Het
Speg T C 1: 75,401,124 F842S probably damaging Het
Stk17b G T 1: 53,757,739 H290N probably damaging Het
Stpg3 A T 2: 25,213,504 V191D probably benign Het
Supt6 C T 11: 78,229,464 R350H probably damaging Het
Taf1b G A 12: 24,516,948 A214T possibly damaging Het
Tet3 T C 6: 83,403,953 E411G possibly damaging Het
Tet3 T A 6: 83,404,826 probably null Het
Tg T C 15: 66,674,064 Y212H probably damaging Het
Tns3 A G 11: 8,445,702 I1234T probably damaging Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tram2 C G 1: 21,003,926 A263P possibly damaging Het
Treml1 T G 17: 48,366,743 S261A probably damaging Het
Trim34b A G 7: 104,331,296 E197G probably damaging Het
Tspan18 C T 2: 93,220,117 G54S probably damaging Het
Wdtc1 A G 4: 133,322,218 V29A probably damaging Het
Zdhhc16 T C 19: 41,940,716 Y253H probably damaging Het
Zfp366 A G 13: 99,229,366 Y345C probably damaging Het
Zfp423 T A 8: 87,783,413 D101V possibly damaging Het
Zfp462 G A 4: 55,080,735 M2450I probably benign Het
Zfp52 C T 17: 21,561,956 L689F possibly damaging Het
Zim1 G A 7: 6,687,740 Q29* probably null Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
antiquity UTSW 2 122340201 missense probably damaging 1.00
Dejavous UTSW 2 122320864 missense probably damaging 1.00
R1706_Duox1_051 UTSW 2 122319472 missense probably benign 0.01
R5032_duox1_732 UTSW 2 122337317 missense probably benign
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 splice site probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7833:Duox1 UTSW 2 122324388 missense probably damaging 1.00
R7980:Duox1 UTSW 2 122347320 missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
R8717:Duox1 UTSW 2 122337671 missense possibly damaging 0.88
R8992:Duox1 UTSW 2 122344705 missense probably damaging 1.00
R9196:Duox1 UTSW 2 122320208 missense probably benign 0.08
R9344:Duox1 UTSW 2 122337682 missense probably benign 0.14
R9397:Duox1 UTSW 2 122320302 missense possibly damaging 0.48
R9491:Duox1 UTSW 2 122326426 missense probably benign 0.01
R9521:Duox1 UTSW 2 122328735 missense possibly damaging 0.81
R9562:Duox1 UTSW 2 122320722 missense probably damaging 1.00
R9565:Duox1 UTSW 2 122320722 missense probably damaging 1.00
R9569:Duox1 UTSW 2 122318490 missense probably benign
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACTACCCAGATCACAGTCC -3'
(R):5'- TGATCCCATGTACACACCTGG -3'

Sequencing Primer
(F):5'- CAACCCCTAGTCCCAGCTATTC -3'
(R):5'- CCATGTACACACCTGGGAGAAAAG -3'
Posted On 2022-07-18