Incidental Mutation 'R9510:Tet3'
ID 718086
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Name tet methylcytosine dioxygenase 3
Synonyms B430006D22Rik, D230004J03Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.552) question?
Stock # R9510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83339355-83434190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83380935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 411 (E411G)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]
AlphaFold Q8BG87
Predicted Effect possibly damaging
Transcript: ENSMUST00000089622
AA Change: E276G

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: E276G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186548
AA Change: E411G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: E411G

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190295
SMART Domains Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 (GRCm39) W6G unknown Het
Aatk A T 11: 119,901,094 (GRCm39) C1101S probably benign Het
Ankrd61 T C 5: 143,828,322 (GRCm39) T218A possibly damaging Het
Cacna1b T C 2: 24,540,058 (GRCm39) E1467G probably damaging Het
Ccdc186 T C 19: 56,802,016 (GRCm39) T34A probably benign Het
Cdc42bpb G A 12: 111,261,372 (GRCm39) P1656S probably benign Het
Cdk13 A C 13: 17,902,747 (GRCm39) C934W probably damaging Het
Cebpg T C 7: 34,750,080 (GRCm39) N61S probably benign Het
Cldn13 T A 5: 134,943,843 (GRCm39) E114V probably benign Het
Clec9a T A 6: 129,398,023 (GRCm39) I187K possibly damaging Het
Cr2 G T 1: 194,840,416 (GRCm39) L509M probably damaging Het
Creb3l2 C A 6: 37,311,446 (GRCm39) G448W probably damaging Het
Csf2rb T A 15: 78,229,760 (GRCm39) probably null Het
Cyth1 C T 11: 118,076,206 (GRCm39) probably null Het
Dapk1 A T 13: 60,910,203 (GRCm39) D1441V unknown Het
Dnhd1 A T 7: 105,352,889 (GRCm39) N2681Y possibly damaging Het
Dnm1 T C 2: 32,213,739 (GRCm39) M476V probably benign Het
Dock1 T G 7: 134,592,279 (GRCm39) I938S probably benign Het
Duox1 G A 2: 122,160,023 (GRCm39) V713I possibly damaging Het
Dusp16 T C 6: 134,695,226 (GRCm39) H535R probably benign Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,610,782 (GRCm39) probably benign Het
Fancd2os T A 6: 113,574,994 (GRCm39) Y4F probably damaging Het
Fat4 A T 3: 39,037,886 (GRCm39) Q3846L probably benign Het
Fbxw10 A C 11: 62,743,814 (GRCm39) H240P probably benign Het
Fer1l5 T C 1: 36,442,662 (GRCm39) L727P probably damaging Het
Fezf1 A C 6: 23,247,845 (GRCm39) F77V probably benign Het
Fli1 T C 9: 32,335,493 (GRCm39) D313G probably damaging Het
Frmd4a A G 2: 4,608,324 (GRCm39) T731A probably benign Het
Gfy T C 7: 44,828,090 (GRCm39) Q2R possibly damaging Het
Ggt5 T C 10: 75,445,139 (GRCm39) V382A probably benign Het
Hira A G 16: 18,772,789 (GRCm39) D867G probably damaging Het
Hmcn1 A G 1: 150,462,127 (GRCm39) S5184P probably benign Het
Ighv1-26 A C 12: 114,752,407 (GRCm39) F7V probably benign Het
Igkv4-81 C T 6: 68,967,796 (GRCm39) E102K possibly damaging Het
Inmt G T 6: 55,147,990 (GRCm39) S213Y possibly damaging Het
Ints2 T A 11: 86,135,335 (GRCm39) M360L probably benign Het
Itih3 A G 14: 30,631,416 (GRCm39) S827P probably benign Het
Kcnk12 C A 17: 88,054,122 (GRCm39) R180L probably benign Het
Klhl2 T C 8: 65,202,113 (GRCm39) N521S probably benign Het
Kmt2a A T 9: 44,734,531 (GRCm39) F2104I unknown Het
Kndc1 G A 7: 139,510,031 (GRCm39) S1291N probably benign Het
Mettl21a T C 1: 64,647,285 (GRCm39) T91A probably damaging Het
Mmrn2 A G 14: 34,120,407 (GRCm39) I426V possibly damaging Het
Mrpl2 T C 17: 46,958,440 (GRCm39) V74A probably benign Het
Msantd4 A G 9: 4,385,007 (GRCm39) D244G probably benign Het
Mtfmt C T 9: 65,343,147 (GRCm39) R18C probably benign Het
Ncam2 A G 16: 81,420,341 (GRCm39) *838W probably null Het
Ncor1 CTG CTGATG 11: 62,324,442 (GRCm39) probably benign Het
Nsf T C 11: 103,763,988 (GRCm39) N365S probably damaging Het
Osbpl3 C T 6: 50,313,194 (GRCm39) probably null Het
Pam C T 1: 97,826,065 (GRCm39) probably null Het
Parn A T 16: 13,358,942 (GRCm39) M600K probably benign Het
Pcdha11 C A 18: 37,139,532 (GRCm39) T387N probably benign Het
Ptprt A C 2: 161,397,381 (GRCm39) C1129G probably damaging Het
Ralgapb T A 2: 158,285,856 (GRCm39) S645T probably damaging Het
Rara C T 11: 98,860,983 (GRCm39) S157L probably benign Het
Rnf40 T A 7: 127,201,808 (GRCm39) I1000N probably damaging Het
Sap25 C T 5: 137,640,494 (GRCm39) T141I probably null Het
Scube2 C T 7: 109,430,969 (GRCm39) G410E probably damaging Het
Sh3gl2 A G 4: 85,304,089 (GRCm39) E264G probably benign Het
Smc4 T G 3: 68,914,662 (GRCm39) S92A probably damaging Het
Sorcs1 C T 19: 50,666,521 (GRCm39) R129Q probably benign Het
Spata31e4 A G 13: 50,856,149 (GRCm39) T596A possibly damaging Het
Spef2 T C 15: 9,713,203 (GRCm39) R390G probably damaging Het
Speg T C 1: 75,377,768 (GRCm39) F842S probably damaging Het
Stk17b G T 1: 53,796,898 (GRCm39) H290N probably damaging Het
Stpg3 A T 2: 25,103,516 (GRCm39) V191D probably benign Het
Supt6 C T 11: 78,120,290 (GRCm39) R350H probably damaging Het
Taf1b G A 12: 24,566,947 (GRCm39) A214T possibly damaging Het
Tg T C 15: 66,545,913 (GRCm39) Y212H probably damaging Het
Tns3 A G 11: 8,395,702 (GRCm39) I1234T probably damaging Het
Traf6 C T 2: 101,521,825 (GRCm39) T220I possibly damaging Het
Tram2 C G 1: 21,074,150 (GRCm39) A263P possibly damaging Het
Treml1 T G 17: 48,673,771 (GRCm39) S261A probably damaging Het
Trim34b A G 7: 103,980,503 (GRCm39) E197G probably damaging Het
Tspan18 C T 2: 93,050,462 (GRCm39) G54S probably damaging Het
Wdtc1 A G 4: 133,049,529 (GRCm39) V29A probably damaging Het
Zdhhc16 T C 19: 41,929,155 (GRCm39) Y253H probably damaging Het
Zfp366 A G 13: 99,365,874 (GRCm39) Y345C probably damaging Het
Zfp423 T A 8: 88,510,041 (GRCm39) D101V possibly damaging Het
Zfp462 G A 4: 55,080,735 (GRCm39) M2450I probably benign Het
Zfp52 C T 17: 21,782,218 (GRCm39) L689F possibly damaging Het
Zim1 G A 7: 6,690,739 (GRCm39) Q29* probably null Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83,345,637 (GRCm39) missense probably benign 0.06
IGL01396:Tet3 APN 6 83,346,620 (GRCm39) nonsense probably null
IGL02344:Tet3 APN 6 83,380,815 (GRCm39) missense probably benign 0.04
IGL02987:Tet3 APN 6 83,345,074 (GRCm39) missense probably damaging 0.99
IGL03126:Tet3 APN 6 83,353,769 (GRCm39) missense probably damaging 1.00
IGL03155:Tet3 APN 6 83,345,365 (GRCm39) missense probably damaging 1.00
IGL03286:Tet3 APN 6 83,352,760 (GRCm39) missense probably damaging 1.00
Reedy UTSW 6 83,345,066 (GRCm39) nonsense probably null
P0033:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R0131:Tet3 UTSW 6 83,345,770 (GRCm39) missense probably damaging 1.00
R0295:Tet3 UTSW 6 83,346,121 (GRCm39) missense probably benign 0.14
R0504:Tet3 UTSW 6 83,350,776 (GRCm39) missense probably damaging 1.00
R0524:Tet3 UTSW 6 83,356,924 (GRCm39) missense probably damaging 1.00
R1061:Tet3 UTSW 6 83,350,305 (GRCm39) missense probably damaging 0.99
R1160:Tet3 UTSW 6 83,381,434 (GRCm39) missense probably benign 0.00
R1550:Tet3 UTSW 6 83,363,010 (GRCm39) missense probably damaging 0.97
R1640:Tet3 UTSW 6 83,346,297 (GRCm39) missense probably benign 0.44
R1658:Tet3 UTSW 6 83,346,039 (GRCm39) missense probably benign 0.44
R1746:Tet3 UTSW 6 83,345,050 (GRCm39) missense probably damaging 1.00
R1761:Tet3 UTSW 6 83,380,641 (GRCm39) missense probably damaging 0.99
R1832:Tet3 UTSW 6 83,380,627 (GRCm39) missense probably benign
R1835:Tet3 UTSW 6 83,381,145 (GRCm39) missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83,381,361 (GRCm39) missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83,363,057 (GRCm39) missense probably damaging 1.00
R2230:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2232:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2922:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R3429:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R3430:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R4291:Tet3 UTSW 6 83,350,181 (GRCm39) missense probably damaging 1.00
R4349:Tet3 UTSW 6 83,380,257 (GRCm39) missense probably benign
R4809:Tet3 UTSW 6 83,379,928 (GRCm39) missense probably benign
R4846:Tet3 UTSW 6 83,353,865 (GRCm39) nonsense probably null
R5039:Tet3 UTSW 6 83,352,878 (GRCm39) missense probably damaging 1.00
R5233:Tet3 UTSW 6 83,363,045 (GRCm39) missense probably damaging 1.00
R5363:Tet3 UTSW 6 83,353,746 (GRCm39) critical splice donor site probably null
R5880:Tet3 UTSW 6 83,347,532 (GRCm39) missense probably damaging 1.00
R6270:Tet3 UTSW 6 83,352,773 (GRCm39) missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83,345,066 (GRCm39) nonsense probably null
R6564:Tet3 UTSW 6 83,363,052 (GRCm39) missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83,380,426 (GRCm39) missense probably benign 0.00
R7089:Tet3 UTSW 6 83,432,006 (GRCm39) missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83,347,603 (GRCm39) missense probably damaging 1.00
R7251:Tet3 UTSW 6 83,381,038 (GRCm39) missense probably benign
R7361:Tet3 UTSW 6 83,345,076 (GRCm39) missense probably benign 0.15
R7436:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7438:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7544:Tet3 UTSW 6 83,381,623 (GRCm39) missense probably damaging 1.00
R7552:Tet3 UTSW 6 83,345,289 (GRCm39) missense probably damaging 1.00
R7942:Tet3 UTSW 6 83,353,956 (GRCm39) missense probably damaging 1.00
R8010:Tet3 UTSW 6 83,380,228 (GRCm39) missense unknown
R8063:Tet3 UTSW 6 83,379,723 (GRCm39) missense probably damaging 1.00
R8307:Tet3 UTSW 6 83,356,909 (GRCm39) missense probably damaging 1.00
R9016:Tet3 UTSW 6 83,345,253 (GRCm39) missense probably damaging 1.00
R9020:Tet3 UTSW 6 83,381,418 (GRCm39) missense probably damaging 1.00
R9377:Tet3 UTSW 6 83,380,596 (GRCm39) missense possibly damaging 0.95
R9476:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9476:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9510:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9582:Tet3 UTSW 6 83,381,226 (GRCm39) missense probably damaging 0.99
R9671:Tet3 UTSW 6 83,381,136 (GRCm39) missense possibly damaging 0.89
R9801:Tet3 UTSW 6 83,346,436 (GRCm39) missense possibly damaging 0.94
X0004:Tet3 UTSW 6 83,380,405 (GRCm39) missense probably benign 0.17
Z1176:Tet3 UTSW 6 83,436,003 (GRCm39) missense unknown
Z1176:Tet3 UTSW 6 83,381,332 (GRCm39) missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83,347,680 (GRCm39) missense probably damaging 1.00
Z1177:Tet3 UTSW 6 83,381,276 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGGATGTAATCACTGGCGCTG -3'
(R):5'- ACTCCTTAGCTCTGAGGTCC -3'

Sequencing Primer
(F):5'- TGCCCAATAGCTGCTCCAG -3'
(R):5'- TTAGCTCTGAGGTCCCCCAG -3'
Posted On 2022-07-18