Incidental Mutation 'R9510:Zim1'
ID 718091
Institutional Source Beutler Lab
Gene Symbol Zim1
Ensembl Gene ENSMUSG00000002266
Gene Name zinc finger, imprinted 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6671269-6696450 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 6687740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 29 (Q29*)
Ref Sequence ENSEMBL: ENSMUSP00000002336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002336] [ENSMUST00000122432] [ENSMUST00000203908]
AlphaFold Q8C393
Predicted Effect probably null
Transcript: ENSMUST00000002336
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000002336
Gene: ENSMUSG00000002266
AA Change: Q29*

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122432
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000113585
Gene: ENSMUSG00000002266
AA Change: Q29*

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203908
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000145453
Gene: ENSMUSG00000002266
AA Change: Q29*

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 W6G unknown Het
Aatk A T 11: 120,010,268 C1101S probably benign Het
Ankrd61 T C 5: 143,891,504 T218A possibly damaging Het
Cacna1b T C 2: 24,650,046 E1467G probably damaging Het
Ccdc186 T C 19: 56,813,584 T34A probably benign Het
Cdc42bpb G A 12: 111,294,938 P1656S probably benign Het
Cdk13 A C 13: 17,728,162 C934W probably damaging Het
Cebpg T C 7: 35,050,655 N61S probably benign Het
Cldn13 T A 5: 134,914,989 E114V probably benign Het
Clec9a T A 6: 129,421,060 I187K possibly damaging Het
Cr2 G T 1: 195,158,108 L509M probably damaging Het
Creb3l2 C A 6: 37,334,511 G448W probably damaging Het
Csf2rb T A 15: 78,345,560 probably null Het
Cyth1 C T 11: 118,185,380 probably null Het
Dapk1 A T 13: 60,762,389 D1441V unknown Het
Dnhd1 A T 7: 105,703,682 N2681Y possibly damaging Het
Dnm1 T C 2: 32,323,727 M476V probably benign Het
Dock1 T G 7: 134,990,550 I938S probably benign Het
Duox1 G A 2: 122,329,542 V713I possibly damaging Het
Dusp16 T C 6: 134,718,263 H535R probably benign Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Fancd2os T A 6: 113,598,033 Y4F probably damaging Het
Fat4 A T 3: 38,983,737 Q3846L probably benign Het
Fbxw10 A C 11: 62,852,988 H240P probably benign Het
Fer1l5 T C 1: 36,403,581 L727P probably damaging Het
Fezf1 A C 6: 23,247,846 F77V probably benign Het
Fli1 T C 9: 32,424,197 D313G probably damaging Het
Frmd4a A G 2: 4,603,513 T731A probably benign Het
Gfy T C 7: 45,178,666 Q2R possibly damaging Het
Ggt5 T C 10: 75,609,305 V382A probably benign Het
Gm8765 A G 13: 50,702,113 T596A possibly damaging Het
Hira A G 16: 18,954,039 D867G probably damaging Het
Hmcn1 A G 1: 150,586,376 S5184P probably benign Het
Ighv1-26 A C 12: 114,788,787 F7V probably benign Het
Igkv4-81 C T 6: 68,990,812 E102K possibly damaging Het
Inmt G T 6: 55,171,005 S213Y possibly damaging Het
Ints2 T A 11: 86,244,509 M360L probably benign Het
Itih3 A G 14: 30,909,459 S827P probably benign Het
Kcnk12 C A 17: 87,746,694 R180L probably benign Het
Klhl2 T C 8: 64,749,079 N521S probably benign Het
Kmt2a A T 9: 44,823,234 F2104I unknown Het
Kndc1 G A 7: 139,930,118 S1291N probably benign Het
Mettl21a T C 1: 64,608,126 T91A probably damaging Het
Mmrn2 A G 14: 34,398,450 I426V possibly damaging Het
Mrpl2 T C 17: 46,647,514 V74A probably benign Het
Msantd4 A G 9: 4,385,007 D244G probably benign Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Ncam2 A G 16: 81,623,453 *838W probably null Het
Ncor1 CTG CTGATG 11: 62,433,616 probably benign Het
Nsf T C 11: 103,873,162 N365S probably damaging Het
Osbpl3 C T 6: 50,336,214 probably null Het
Pam C T 1: 97,898,340 probably null Het
Parn A T 16: 13,541,078 M600K probably benign Het
Pcdha11 C A 18: 37,006,479 T387N probably benign Het
Ptprt A C 2: 161,555,461 C1129G probably damaging Het
Ralgapb T A 2: 158,443,936 S645T probably damaging Het
Rara C T 11: 98,970,157 S157L probably benign Het
Rnf40 T A 7: 127,602,636 I1000N probably damaging Het
Sap25 C T 5: 137,642,232 T141I probably null Het
Scube2 C T 7: 109,831,762 G410E probably damaging Het
Sh3gl2 A G 4: 85,385,852 E264G probably benign Het
Smc4 T G 3: 69,007,329 S92A probably damaging Het
Sorcs1 C T 19: 50,678,083 R129Q probably benign Het
Spef2 T C 15: 9,713,117 R390G probably damaging Het
Speg T C 1: 75,401,124 F842S probably damaging Het
Stk17b G T 1: 53,757,739 H290N probably damaging Het
Stpg3 A T 2: 25,213,504 V191D probably benign Het
Supt6 C T 11: 78,229,464 R350H probably damaging Het
Taf1b G A 12: 24,516,948 A214T possibly damaging Het
Tet3 T C 6: 83,403,953 E411G possibly damaging Het
Tet3 T A 6: 83,404,826 probably null Het
Tg T C 15: 66,674,064 Y212H probably damaging Het
Tns3 A G 11: 8,445,702 I1234T probably damaging Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tram2 C G 1: 21,003,926 A263P possibly damaging Het
Treml1 T G 17: 48,366,743 S261A probably damaging Het
Trim34b A G 7: 104,331,296 E197G probably damaging Het
Tspan18 C T 2: 93,220,117 G54S probably damaging Het
Wdtc1 A G 4: 133,322,218 V29A probably damaging Het
Zdhhc16 T C 19: 41,940,716 Y253H probably damaging Het
Zfp366 A G 13: 99,229,366 Y345C probably damaging Het
Zfp423 T A 8: 87,783,413 D101V possibly damaging Het
Zfp462 G A 4: 55,080,735 M2450I probably benign Het
Zfp52 C T 17: 21,561,956 L689F possibly damaging Het
Other mutations in Zim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Zim1 APN 7 6682760 missense possibly damaging 0.95
IGL01921:Zim1 APN 7 6682185 splice site probably benign
IGL02116:Zim1 APN 7 6678254 missense probably benign 0.00
IGL02252:Zim1 APN 7 6688628 missense unknown
IGL02354:Zim1 APN 7 6682874 splice site probably null
IGL02361:Zim1 APN 7 6682874 splice site probably null
IGL03025:Zim1 APN 7 6682059 missense probably benign 0.00
R0003:Zim1 UTSW 7 6676948 missense probably benign 0.01
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1483:Zim1 UTSW 7 6682125 missense probably benign 0.00
R2106:Zim1 UTSW 7 6678074 missense probably benign 0.02
R2315:Zim1 UTSW 7 6677068 missense possibly damaging 0.86
R2508:Zim1 UTSW 7 6677430 small insertion probably benign
R2508:Zim1 UTSW 7 6677431 small insertion probably benign
R3706:Zim1 UTSW 7 6677291 missense probably damaging 0.97
R3975:Zim1 UTSW 7 6677130 missense probably damaging 1.00
R5524:Zim1 UTSW 7 6677321 missense probably benign 0.34
R5557:Zim1 UTSW 7 6677711 missense probably damaging 1.00
R5843:Zim1 UTSW 7 6677698 missense possibly damaging 0.59
R5844:Zim1 UTSW 7 6678116 missense probably benign 0.21
R5882:Zim1 UTSW 7 6682738 critical splice donor site probably null
R6828:Zim1 UTSW 7 6677689 missense probably damaging 1.00
R6953:Zim1 UTSW 7 6687707 missense unknown
R7080:Zim1 UTSW 7 6677306 missense possibly damaging 0.92
R7148:Zim1 UTSW 7 6678221 missense possibly damaging 0.91
R7199:Zim1 UTSW 7 6677873 nonsense probably null
R7332:Zim1 UTSW 7 6677353 missense probably damaging 1.00
R7462:Zim1 UTSW 7 6677812 missense probably damaging 1.00
R8350:Zim1 UTSW 7 6682065 missense probably damaging 0.99
R9480:Zim1 UTSW 7 6678051 missense probably benign 0.20
R9761:Zim1 UTSW 7 6677772 missense probably damaging 1.00
Z1088:Zim1 UTSW 7 6677659 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GAAGTTGGTGTCATCCTACCAG -3'
(R):5'- GTCAACTACCTGCCTGGAATG -3'

Sequencing Primer
(F):5'- TGTCATCCTACCAGAGATGGG -3'
(R):5'- CTACCTGCCTGGAATGTAGTACAG -3'
Posted On 2022-07-18