Incidental Mutation 'R9510:Kndc1'
ID 718099
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139930118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1291 (S1291N)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: S1291N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S1291N

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 W6G unknown Het
Aatk A T 11: 120,010,268 C1101S probably benign Het
Ankrd61 T C 5: 143,891,504 T218A possibly damaging Het
Cacna1b T C 2: 24,650,046 E1467G probably damaging Het
Ccdc186 T C 19: 56,813,584 T34A probably benign Het
Cdc42bpb G A 12: 111,294,938 P1656S probably benign Het
Cdk13 A C 13: 17,728,162 C934W probably damaging Het
Cebpg T C 7: 35,050,655 N61S probably benign Het
Cldn13 T A 5: 134,914,989 E114V probably benign Het
Clec9a T A 6: 129,421,060 I187K possibly damaging Het
Cr2 G T 1: 195,158,108 L509M probably damaging Het
Creb3l2 C A 6: 37,334,511 G448W probably damaging Het
Csf2rb T A 15: 78,345,560 probably null Het
Cyth1 C T 11: 118,185,380 probably null Het
Dapk1 A T 13: 60,762,389 D1441V unknown Het
Dnhd1 A T 7: 105,703,682 N2681Y possibly damaging Het
Dnm1 T C 2: 32,323,727 M476V probably benign Het
Dock1 T G 7: 134,990,550 I938S probably benign Het
Duox1 G A 2: 122,329,542 V713I possibly damaging Het
Dusp16 T C 6: 134,718,263 H535R probably benign Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Fancd2os T A 6: 113,598,033 Y4F probably damaging Het
Fat4 A T 3: 38,983,737 Q3846L probably benign Het
Fbxw10 A C 11: 62,852,988 H240P probably benign Het
Fer1l5 T C 1: 36,403,581 L727P probably damaging Het
Fezf1 A C 6: 23,247,846 F77V probably benign Het
Fli1 T C 9: 32,424,197 D313G probably damaging Het
Frmd4a A G 2: 4,603,513 T731A probably benign Het
Gfy T C 7: 45,178,666 Q2R possibly damaging Het
Ggt5 T C 10: 75,609,305 V382A probably benign Het
Gm8765 A G 13: 50,702,113 T596A possibly damaging Het
Hira A G 16: 18,954,039 D867G probably damaging Het
Hmcn1 A G 1: 150,586,376 S5184P probably benign Het
Ighv1-26 A C 12: 114,788,787 F7V probably benign Het
Igkv4-81 C T 6: 68,990,812 E102K possibly damaging Het
Inmt G T 6: 55,171,005 S213Y possibly damaging Het
Ints2 T A 11: 86,244,509 M360L probably benign Het
Itih3 A G 14: 30,909,459 S827P probably benign Het
Kcnk12 C A 17: 87,746,694 R180L probably benign Het
Klhl2 T C 8: 64,749,079 N521S probably benign Het
Kmt2a A T 9: 44,823,234 F2104I unknown Het
Mettl21a T C 1: 64,608,126 T91A probably damaging Het
Mmrn2 A G 14: 34,398,450 I426V possibly damaging Het
Mrpl2 T C 17: 46,647,514 V74A probably benign Het
Msantd4 A G 9: 4,385,007 D244G probably benign Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Ncam2 A G 16: 81,623,453 *838W probably null Het
Ncor1 CTG CTGATG 11: 62,433,616 probably benign Het
Nsf T C 11: 103,873,162 N365S probably damaging Het
Osbpl3 C T 6: 50,336,214 probably null Het
Pam C T 1: 97,898,340 probably null Het
Parn A T 16: 13,541,078 M600K probably benign Het
Pcdha11 C A 18: 37,006,479 T387N probably benign Het
Ptprt A C 2: 161,555,461 C1129G probably damaging Het
Ralgapb T A 2: 158,443,936 S645T probably damaging Het
Rara C T 11: 98,970,157 S157L probably benign Het
Rnf40 T A 7: 127,602,636 I1000N probably damaging Het
Sap25 C T 5: 137,642,232 T141I probably null Het
Scube2 C T 7: 109,831,762 G410E probably damaging Het
Sh3gl2 A G 4: 85,385,852 E264G probably benign Het
Smc4 T G 3: 69,007,329 S92A probably damaging Het
Sorcs1 C T 19: 50,678,083 R129Q probably benign Het
Spef2 T C 15: 9,713,117 R390G probably damaging Het
Speg T C 1: 75,401,124 F842S probably damaging Het
Stk17b G T 1: 53,757,739 H290N probably damaging Het
Stpg3 A T 2: 25,213,504 V191D probably benign Het
Supt6 C T 11: 78,229,464 R350H probably damaging Het
Taf1b G A 12: 24,516,948 A214T possibly damaging Het
Tet3 T C 6: 83,403,953 E411G possibly damaging Het
Tet3 T A 6: 83,404,826 probably null Het
Tg T C 15: 66,674,064 Y212H probably damaging Het
Tns3 A G 11: 8,445,702 I1234T probably damaging Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tram2 C G 1: 21,003,926 A263P possibly damaging Het
Treml1 T G 17: 48,366,743 S261A probably damaging Het
Trim34b A G 7: 104,331,296 E197G probably damaging Het
Tspan18 C T 2: 93,220,117 G54S probably damaging Het
Wdtc1 A G 4: 133,322,218 V29A probably damaging Het
Zdhhc16 T C 19: 41,940,716 Y253H probably damaging Het
Zfp366 A G 13: 99,229,366 Y345C probably damaging Het
Zfp423 T A 8: 87,783,413 D101V possibly damaging Het
Zfp462 G A 4: 55,080,735 M2450I probably benign Het
Zfp52 C T 17: 21,561,956 L689F possibly damaging Het
Zim1 G A 7: 6,687,740 Q29* probably null Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTAGAATCACAGGCACGCTC -3'
(R):5'- CCCCTGCTTTCTTGAGGAAG -3'

Sequencing Primer
(F):5'- AGGCACGCTCACTCATTG -3'
(R):5'- AAGCAGTAAGGGCCCTTCCAG -3'
Posted On 2022-07-18