Incidental Mutation 'R9510:Kndc1'
ID 718099
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139510031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1291 (S1291N)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: S1291N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S1291N

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T G 4: 42,760,998 (GRCm39) W6G unknown Het
Aatk A T 11: 119,901,094 (GRCm39) C1101S probably benign Het
Ankrd61 T C 5: 143,828,322 (GRCm39) T218A possibly damaging Het
Cacna1b T C 2: 24,540,058 (GRCm39) E1467G probably damaging Het
Ccdc186 T C 19: 56,802,016 (GRCm39) T34A probably benign Het
Cdc42bpb G A 12: 111,261,372 (GRCm39) P1656S probably benign Het
Cdk13 A C 13: 17,902,747 (GRCm39) C934W probably damaging Het
Cebpg T C 7: 34,750,080 (GRCm39) N61S probably benign Het
Cldn13 T A 5: 134,943,843 (GRCm39) E114V probably benign Het
Clec9a T A 6: 129,398,023 (GRCm39) I187K possibly damaging Het
Cr2 G T 1: 194,840,416 (GRCm39) L509M probably damaging Het
Creb3l2 C A 6: 37,311,446 (GRCm39) G448W probably damaging Het
Csf2rb T A 15: 78,229,760 (GRCm39) probably null Het
Cyth1 C T 11: 118,076,206 (GRCm39) probably null Het
Dapk1 A T 13: 60,910,203 (GRCm39) D1441V unknown Het
Dnhd1 A T 7: 105,352,889 (GRCm39) N2681Y possibly damaging Het
Dnm1 T C 2: 32,213,739 (GRCm39) M476V probably benign Het
Dock1 T G 7: 134,592,279 (GRCm39) I938S probably benign Het
Duox1 G A 2: 122,160,023 (GRCm39) V713I possibly damaging Het
Dusp16 T C 6: 134,695,226 (GRCm39) H535R probably benign Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,610,782 (GRCm39) probably benign Het
Fancd2os T A 6: 113,574,994 (GRCm39) Y4F probably damaging Het
Fat4 A T 3: 39,037,886 (GRCm39) Q3846L probably benign Het
Fbxw10 A C 11: 62,743,814 (GRCm39) H240P probably benign Het
Fer1l5 T C 1: 36,442,662 (GRCm39) L727P probably damaging Het
Fezf1 A C 6: 23,247,845 (GRCm39) F77V probably benign Het
Fli1 T C 9: 32,335,493 (GRCm39) D313G probably damaging Het
Frmd4a A G 2: 4,608,324 (GRCm39) T731A probably benign Het
Gfy T C 7: 44,828,090 (GRCm39) Q2R possibly damaging Het
Ggt5 T C 10: 75,445,139 (GRCm39) V382A probably benign Het
Hira A G 16: 18,772,789 (GRCm39) D867G probably damaging Het
Hmcn1 A G 1: 150,462,127 (GRCm39) S5184P probably benign Het
Ighv1-26 A C 12: 114,752,407 (GRCm39) F7V probably benign Het
Igkv4-81 C T 6: 68,967,796 (GRCm39) E102K possibly damaging Het
Inmt G T 6: 55,147,990 (GRCm39) S213Y possibly damaging Het
Ints2 T A 11: 86,135,335 (GRCm39) M360L probably benign Het
Itih3 A G 14: 30,631,416 (GRCm39) S827P probably benign Het
Kcnk12 C A 17: 88,054,122 (GRCm39) R180L probably benign Het
Klhl2 T C 8: 65,202,113 (GRCm39) N521S probably benign Het
Kmt2a A T 9: 44,734,531 (GRCm39) F2104I unknown Het
Mettl21a T C 1: 64,647,285 (GRCm39) T91A probably damaging Het
Mmrn2 A G 14: 34,120,407 (GRCm39) I426V possibly damaging Het
Mrpl2 T C 17: 46,958,440 (GRCm39) V74A probably benign Het
Msantd4 A G 9: 4,385,007 (GRCm39) D244G probably benign Het
Mtfmt C T 9: 65,343,147 (GRCm39) R18C probably benign Het
Ncam2 A G 16: 81,420,341 (GRCm39) *838W probably null Het
Ncor1 CTG CTGATG 11: 62,324,442 (GRCm39) probably benign Het
Nsf T C 11: 103,763,988 (GRCm39) N365S probably damaging Het
Osbpl3 C T 6: 50,313,194 (GRCm39) probably null Het
Pam C T 1: 97,826,065 (GRCm39) probably null Het
Parn A T 16: 13,358,942 (GRCm39) M600K probably benign Het
Pcdha11 C A 18: 37,139,532 (GRCm39) T387N probably benign Het
Ptprt A C 2: 161,397,381 (GRCm39) C1129G probably damaging Het
Ralgapb T A 2: 158,285,856 (GRCm39) S645T probably damaging Het
Rara C T 11: 98,860,983 (GRCm39) S157L probably benign Het
Rnf40 T A 7: 127,201,808 (GRCm39) I1000N probably damaging Het
Sap25 C T 5: 137,640,494 (GRCm39) T141I probably null Het
Scube2 C T 7: 109,430,969 (GRCm39) G410E probably damaging Het
Sh3gl2 A G 4: 85,304,089 (GRCm39) E264G probably benign Het
Smc4 T G 3: 68,914,662 (GRCm39) S92A probably damaging Het
Sorcs1 C T 19: 50,666,521 (GRCm39) R129Q probably benign Het
Spata31e4 A G 13: 50,856,149 (GRCm39) T596A possibly damaging Het
Spef2 T C 15: 9,713,203 (GRCm39) R390G probably damaging Het
Speg T C 1: 75,377,768 (GRCm39) F842S probably damaging Het
Stk17b G T 1: 53,796,898 (GRCm39) H290N probably damaging Het
Stpg3 A T 2: 25,103,516 (GRCm39) V191D probably benign Het
Supt6 C T 11: 78,120,290 (GRCm39) R350H probably damaging Het
Taf1b G A 12: 24,566,947 (GRCm39) A214T possibly damaging Het
Tet3 T C 6: 83,380,935 (GRCm39) E411G possibly damaging Het
Tet3 T A 6: 83,381,808 (GRCm39) probably null Het
Tg T C 15: 66,545,913 (GRCm39) Y212H probably damaging Het
Tns3 A G 11: 8,395,702 (GRCm39) I1234T probably damaging Het
Traf6 C T 2: 101,521,825 (GRCm39) T220I possibly damaging Het
Tram2 C G 1: 21,074,150 (GRCm39) A263P possibly damaging Het
Treml1 T G 17: 48,673,771 (GRCm39) S261A probably damaging Het
Trim34b A G 7: 103,980,503 (GRCm39) E197G probably damaging Het
Tspan18 C T 2: 93,050,462 (GRCm39) G54S probably damaging Het
Wdtc1 A G 4: 133,049,529 (GRCm39) V29A probably damaging Het
Zdhhc16 T C 19: 41,929,155 (GRCm39) Y253H probably damaging Het
Zfp366 A G 13: 99,365,874 (GRCm39) Y345C probably damaging Het
Zfp423 T A 8: 88,510,041 (GRCm39) D101V possibly damaging Het
Zfp462 G A 4: 55,080,735 (GRCm39) M2450I probably benign Het
Zfp52 C T 17: 21,782,218 (GRCm39) L689F possibly damaging Het
Zim1 G A 7: 6,690,739 (GRCm39) Q29* probably null Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTAGAATCACAGGCACGCTC -3'
(R):5'- CCCCTGCTTTCTTGAGGAAG -3'

Sequencing Primer
(F):5'- AGGCACGCTCACTCATTG -3'
(R):5'- AAGCAGTAAGGGCCCTTCCAG -3'
Posted On 2022-07-18