Mutagenetix > Incidental Mutation

Incidental Mutation 'R9510:Ints2'

718111

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9510 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86244509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 360 (M360L)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: M360L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: M360L

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: M360L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: M360L

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578G10Rik	T	G	4: 42,760,998	W6G	unknown	Het
Aatk	A	T	11: 120,010,268	C1101S	probably benign	Het
Ankrd61	T	C	5: 143,891,504	T218A	possibly damaging	Het
Cacna1b	T	C	2: 24,650,046	E1467G	probably damaging	Het
Ccdc186	T	C	19: 56,813,584	T34A	probably benign	Het
Cdc42bpb	G	A	12: 111,294,938	P1656S	probably benign	Het
Cdk13	A	C	13: 17,728,162	C934W	probably damaging	Het
Cebpg	T	C	7: 35,050,655	N61S	probably benign	Het
Cldn13	T	A	5: 134,914,989	E114V	probably benign	Het
Clec9a	T	A	6: 129,421,060	I187K	possibly damaging	Het
Cr2	G	T	1: 195,158,108	L509M	probably damaging	Het
Creb3l2	C	A	6: 37,334,511	G448W	probably damaging	Het
Csf2rb	T	A	15: 78,345,560		probably null	Het
Cyth1	C	T	11: 118,185,380		probably null	Het
Dapk1	A	T	13: 60,762,389	D1441V	unknown	Het
Dnhd1	A	T	7: 105,703,682	N2681Y	possibly damaging	Het
Dnm1	T	C	2: 32,323,727	M476V	probably benign	Het
Dock1	T	G	7: 134,990,550	I938S	probably benign	Het
Duox1	G	A	2: 122,329,542	V713I	possibly damaging	Het
Dusp16	T	C	6: 134,718,263	H535R	probably benign	Het
Eif3j2	TGCCGCCGCCGCCGCCGCCGCCGCCGCC	TGCCGCCGCCGCCGCCGCCGCCGCC	18: 43,477,717		probably benign	Het
Fancd2os	T	A	6: 113,598,033	Y4F	probably damaging	Het
Fat4	A	T	3: 38,983,737	Q3846L	probably benign	Het
Fbxw10	A	C	11: 62,852,988	H240P	probably benign	Het
Fer1l5	T	C	1: 36,403,581	L727P	probably damaging	Het
Fezf1	A	C	6: 23,247,846	F77V	probably benign	Het
Fli1	T	C	9: 32,424,197	D313G	probably damaging	Het
Frmd4a	A	G	2: 4,603,513	T731A	probably benign	Het
Gfy	T	C	7: 45,178,666	Q2R	possibly damaging	Het
Ggt5	T	C	10: 75,609,305	V382A	probably benign	Het
Gm8765	A	G	13: 50,702,113	T596A	possibly damaging	Het
Hira	A	G	16: 18,954,039	D867G	probably damaging	Het
Hmcn1	A	G	1: 150,586,376	S5184P	probably benign	Het
Ighv1-26	A	C	12: 114,788,787	F7V	probably benign	Het
Igkv4-81	C	T	6: 68,990,812	E102K	possibly damaging	Het
Inmt	G	T	6: 55,171,005	S213Y	possibly damaging	Het
Itih3	A	G	14: 30,909,459	S827P	probably benign	Het
Kcnk12	C	A	17: 87,746,694	R180L	probably benign	Het
Klhl2	T	C	8: 64,749,079	N521S	probably benign	Het
Kmt2a	A	T	9: 44,823,234	F2104I	unknown	Het
Kndc1	G	A	7: 139,930,118	S1291N	probably benign	Het
Mettl21a	T	C	1: 64,608,126	T91A	probably damaging	Het
Mmrn2	A	G	14: 34,398,450	I426V	possibly damaging	Het
Mrpl2	T	C	17: 46,647,514	V74A	probably benign	Het
Msantd4	A	G	9: 4,385,007	D244G	probably benign	Het
Mtfmt	C	T	9: 65,435,865	R18C	probably benign	Het
Ncam2	A	G	16: 81,623,453	*838W	probably null	Het
Ncor1	CTG	CTGATG	11: 62,433,616		probably benign	Het
Nsf	T	C	11: 103,873,162	N365S	probably damaging	Het
Osbpl3	C	T	6: 50,336,214		probably null	Het
Pam	C	T	1: 97,898,340		probably null	Het
Parn	A	T	16: 13,541,078	M600K	probably benign	Het
Pcdha11	C	A	18: 37,006,479	T387N	probably benign	Het
Ptprt	A	C	2: 161,555,461	C1129G	probably damaging	Het
Ralgapb	T	A	2: 158,443,936	S645T	probably damaging	Het
Rara	C	T	11: 98,970,157	S157L	probably benign	Het
Rnf40	T	A	7: 127,602,636	I1000N	probably damaging	Het
Sap25	C	T	5: 137,642,232	T141I	probably null	Het
Scube2	C	T	7: 109,831,762	G410E	probably damaging	Het
Sh3gl2	A	G	4: 85,385,852	E264G	probably benign	Het
Smc4	T	G	3: 69,007,329	S92A	probably damaging	Het
Sorcs1	C	T	19: 50,678,083	R129Q	probably benign	Het
Spef2	T	C	15: 9,713,117	R390G	probably damaging	Het
Speg	T	C	1: 75,401,124	F842S	probably damaging	Het
Stk17b	G	T	1: 53,757,739	H290N	probably damaging	Het
Stpg3	A	T	2: 25,213,504	V191D	probably benign	Het
Supt6	C	T	11: 78,229,464	R350H	probably damaging	Het
Taf1b	G	A	12: 24,516,948	A214T	possibly damaging	Het
Tet3	T	C	6: 83,403,953	E411G	possibly damaging	Het
Tet3	T	A	6: 83,404,826		probably null	Het
Tg	T	C	15: 66,674,064	Y212H	probably damaging	Het
Tns3	A	G	11: 8,445,702	I1234T	probably damaging	Het
Traf6	C	T	2: 101,691,480	T220I	possibly damaging	Het
Tram2	C	G	1: 21,003,926	A263P	possibly damaging	Het
Treml1	T	G	17: 48,366,743	S261A	probably damaging	Het
Trim34b	A	G	7: 104,331,296	E197G	probably damaging	Het
Tspan18	C	T	2: 93,220,117	G54S	probably damaging	Het
Wdtc1	A	G	4: 133,322,218	V29A	probably damaging	Het
Zdhhc16	T	C	19: 41,940,716	Y253H	probably damaging	Het
Zfp366	A	G	13: 99,229,366	Y345C	probably damaging	Het
Zfp423	T	A	8: 87,783,413	D101V	possibly damaging	Het
Zfp462	G	A	4: 55,080,735	M2450I	probably benign	Het
Zfp52	C	T	17: 21,561,956	L689F	possibly damaging	Het
Zim1	G	A	7: 6,687,740	Q29*	probably null	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCTCTTAATAAAGGCCTTTGGTTC -3'
(R):5'- AAGTGCTCATGTGACAAGATCC -3'

Sequencing Primer
(F):5'- CACTTCTGTGAGATGAGAACCAAG -3'
(R):5'- GTGCTCATGTGACAAGATCCATTCAG -3'

Posted On

2022-07-18