Incidental Mutation 'R9511:Ankar'
ID 718142
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72680002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 563 (R563C)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably benign
Transcript: ENSMUST00000053499
AA Change: R563C

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: R563C

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000211837
AA Change: R563C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Abca13 T A 11: 9,328,130 S3103R probably benign Het
Alg9 A C 9: 50,806,225 Y436S probably damaging Het
Ankrd34a C A 3: 96,598,085 R202S probably benign Het
Art4 T A 6: 136,854,615 N176I possibly damaging Het
Bivm A G 1: 44,143,090 E486G possibly damaging Het
Ccdc3 C A 2: 5,138,279 Q116K probably damaging Het
Cdc42bpb G A 12: 111,294,938 P1656S probably benign Het
Cdh6 T C 15: 13,034,591 D661G probably damaging Het
Chek1 T C 9: 36,713,451 N368S probably benign Het
Dnah11 A T 12: 117,914,617 F3924L probably damaging Het
Dusp7 T C 9: 106,370,926 I251T probably damaging Het
Dysf T A 6: 84,113,668 W988R probably damaging Het
Dzip1l T C 9: 99,637,657 V79A possibly damaging Het
Ebf1 A G 11: 44,924,566 I344V probably benign Het
Ern2 T C 7: 122,177,600 E336G probably benign Het
Fat4 T C 3: 38,980,653 L2818P probably damaging Het
Gjb3 T C 4: 127,326,338 S134G probably damaging Het
Gm10647 T C 9: 66,798,474 F108L unknown Het
Gm19410 A T 8: 35,790,694 D762V probably damaging Het
Gm8251 T G 1: 44,059,694 D748A probably benign Het
Gper1 A G 5: 139,426,383 K161R probably benign Het
Grin1 A G 2: 25,297,414 M628T probably damaging Het
Gsdmc A T 15: 63,778,048 D331E probably benign Het
Haus3 C A 5: 34,168,227 W29C probably damaging Het
Il10ra T C 9: 45,256,392 E289G probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnma1 T C 14: 23,311,725 T1133A possibly damaging Het
Ksr1 G A 11: 79,033,268 T458M possibly damaging Het
Mc5r T A 18: 68,339,494 M308K possibly damaging Het
Mis18a T C 16: 90,721,637 S146G possibly damaging Het
Mrpl50 G A 4: 49,514,501 R57* probably null Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Nanos1 T A 19: 60,756,975 I237N probably damaging Het
Ncor1 TGC TGCGGC 11: 62,433,623 probably benign Het
Ndst3 T A 3: 123,606,906 E450D probably damaging Het
Nek10 C A 14: 14,828,511 T111K probably benign Het
Nipal2 T C 15: 34,584,687 Y245C probably damaging Het
Npat T A 9: 53,562,106 D399E probably benign Het
Olfr1454 T C 19: 13,063,755 S115P probably damaging Het
Opa1 A G 16: 29,610,920 S378G probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pex16 A T 2: 92,379,214 probably null Het
Plec A T 15: 76,174,697 I3680N probably damaging Het
Plin3 A T 17: 56,284,225 V185E probably damaging Het
Prex1 T A 2: 166,571,561 D1512V probably damaging Het
Ptpn22 T A 3: 103,885,597 S355T probably benign Het
Scn5a A G 9: 119,522,545 I790T probably benign Het
Sema6d T C 2: 124,658,023 F340L probably damaging Het
Sh2b1 AGCTC AGCTCCGCCACGGGGACCCGCTC 7: 126,467,578 probably benign Het
Slc22a2 A G 17: 12,610,029 T341A probably damaging Het
Slc6a6 T C 6: 91,744,940 Y374H probably damaging Het
Slitrk3 T G 3: 73,050,939 S167R possibly damaging Het
Smchd1 G A 17: 71,443,904 H340Y possibly damaging Het
Sorcs1 C T 19: 50,678,083 R129Q probably benign Het
Sox9 A G 11: 112,785,175 T397A possibly damaging Het
Tnpo1 C A 13: 98,867,113 R245L possibly damaging Het
Traip T A 9: 107,961,586 M183K probably damaging Het
Trpc6 A T 9: 8,680,418 E882D probably benign Het
Uba6 C A 5: 86,140,360 G491V probably damaging Het
Uqcrfs1 A T 13: 30,545,054 V65E probably benign Het
Urgcp T C 11: 5,718,128 D113G probably damaging Het
Wdr76 C T 2: 121,542,495 T503M probably damaging Het
Zfp27 T C 7: 29,894,216 T775A possibly damaging Het
Zfp518b A T 5: 38,672,052 V870E possibly damaging Het
Zfp932 T A 5: 110,007,311 H63Q possibly damaging Het
Zkscan6 C A 11: 65,821,991 T250N probably damaging Het
Zmat2 A T 18: 36,797,905 K161N possibly damaging Het
Zyg11a A G 4: 108,205,223 L127P probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
R9577:Ankar UTSW 1 72681908 missense probably benign 0.02
R9612:Ankar UTSW 1 72665135 missense possibly damaging 0.65
R9647:Ankar UTSW 1 72650148 missense probably damaging 1.00
R9803:Ankar UTSW 1 72659181 missense possibly damaging 0.47
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGTGAATGTACCTATTTATCAGCAGG -3'
(R):5'- AAGTCTGCTGTTGAAAGAGGC -3'

Sequencing Primer
(F):5'- TTTATCAGCAGGTAGAAATCTGAGG -3'
(R):5'- AAAGAGGCTTGTCTGCTGTTTTCTAC -3'
Posted On 2022-07-18