Incidental Mutation 'R9511:Fat4'
ID 718150
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9511 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 38941089-39066134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39034802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2818 (L2818P)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: L2818P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: L2818P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,445,848 (GRCm39) probably benign Het
Abca13 T A 11: 9,278,130 (GRCm39) S3103R probably benign Het
Alg9 A C 9: 50,717,525 (GRCm39) Y436S probably damaging Het
Ankar G A 1: 72,719,161 (GRCm39) R563C probably benign Het
Ankrd34a C A 3: 96,505,401 (GRCm39) R202S probably benign Het
Art4 T A 6: 136,831,613 (GRCm39) N176I possibly damaging Het
Bivm A G 1: 44,182,250 (GRCm39) E486G possibly damaging Het
Ccdc168 T G 1: 44,098,854 (GRCm39) D748A probably benign Het
Ccdc3 C A 2: 5,143,090 (GRCm39) Q116K probably damaging Het
Cdc42bpb G A 12: 111,261,372 (GRCm39) P1656S probably benign Het
Cdh6 T C 15: 13,034,677 (GRCm39) D661G probably damaging Het
Chek1 T C 9: 36,624,747 (GRCm39) N368S probably benign Het
Dnah11 A T 12: 117,878,352 (GRCm39) F3924L probably damaging Het
Dusp7 T C 9: 106,248,125 (GRCm39) I251T probably damaging Het
Dysf T A 6: 84,090,650 (GRCm39) W988R probably damaging Het
Dzip1l T C 9: 99,519,710 (GRCm39) V79A possibly damaging Het
Ebf1 A G 11: 44,815,393 (GRCm39) I344V probably benign Het
Ern2 T C 7: 121,776,823 (GRCm39) E336G probably benign Het
Gjb3 T C 4: 127,220,131 (GRCm39) S134G probably damaging Het
Gm10647 T C 9: 66,705,756 (GRCm39) F108L unknown Het
Gm19410 A T 8: 36,257,848 (GRCm39) D762V probably damaging Het
Gper1 A G 5: 139,412,138 (GRCm39) K161R probably benign Het
Grin1 A G 2: 25,187,426 (GRCm39) M628T probably damaging Het
Gsdmc A T 15: 63,649,897 (GRCm39) D331E probably benign Het
Haus3 C A 5: 34,325,571 (GRCm39) W29C probably damaging Het
Il10ra T C 9: 45,167,690 (GRCm39) E289G probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnma1 T C 14: 23,361,793 (GRCm39) T1133A possibly damaging Het
Ksr1 G A 11: 78,924,094 (GRCm39) T458M possibly damaging Het
Mc5r T A 18: 68,472,565 (GRCm39) M308K possibly damaging Het
Mis18a T C 16: 90,518,525 (GRCm39) S146G possibly damaging Het
Mrpl50 G A 4: 49,514,501 (GRCm39) R57* probably null Het
Mtfmt C T 9: 65,343,147 (GRCm39) R18C probably benign Het
Nanos1 T A 19: 60,745,413 (GRCm39) I237N probably damaging Het
Ncor1 TGC TGCGGC 11: 62,324,449 (GRCm39) probably benign Het
Ndst3 T A 3: 123,400,555 (GRCm39) E450D probably damaging Het
Nek10 C A 14: 14,828,511 (GRCm38) T111K probably benign Het
Nipal2 T C 15: 34,584,833 (GRCm39) Y245C probably damaging Het
Npat T A 9: 53,473,406 (GRCm39) D399E probably benign Het
Opa1 A G 16: 29,429,738 (GRCm39) S378G probably damaging Het
Or5b102 T C 19: 13,041,119 (GRCm39) S115P probably damaging Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Pex16 A T 2: 92,209,559 (GRCm39) probably null Het
Plec A T 15: 76,058,897 (GRCm39) I3680N probably damaging Het
Plin3 A T 17: 56,591,225 (GRCm39) V185E probably damaging Het
Prex1 T A 2: 166,413,481 (GRCm39) D1512V probably damaging Het
Ptpn22 T A 3: 103,792,913 (GRCm39) S355T probably benign Het
Ranbp3l A G 15: 9,041,991 (GRCm39) probably benign Het
Scn5a A G 9: 119,351,611 (GRCm39) I790T probably benign Het
Sema6d T C 2: 124,499,943 (GRCm39) F340L probably damaging Het
Slc22a2 A G 17: 12,828,916 (GRCm39) T341A probably damaging Het
Slc6a6 T C 6: 91,721,921 (GRCm39) Y374H probably damaging Het
Slitrk3 T G 3: 72,958,272 (GRCm39) S167R possibly damaging Het
Smchd1 G A 17: 71,750,899 (GRCm39) H340Y possibly damaging Het
Sorcs1 C T 19: 50,666,521 (GRCm39) R129Q probably benign Het
Sox9 A G 11: 112,676,001 (GRCm39) T397A possibly damaging Het
Tnpo1 C A 13: 99,003,621 (GRCm39) R245L possibly damaging Het
Traip T A 9: 107,838,785 (GRCm39) M183K probably damaging Het
Trpc6 A T 9: 8,680,419 (GRCm39) E882D probably benign Het
Uba6 C A 5: 86,288,219 (GRCm39) G491V probably damaging Het
Uqcrfs1 A T 13: 30,729,037 (GRCm39) V65E probably benign Het
Urgcp T C 11: 5,668,128 (GRCm39) D113G probably damaging Het
Wdr76 C T 2: 121,372,976 (GRCm39) T503M probably damaging Het
Zfp27 T C 7: 29,593,641 (GRCm39) T775A possibly damaging Het
Zfp518b A T 5: 38,829,395 (GRCm39) V870E possibly damaging Het
Zfp932 T A 5: 110,155,177 (GRCm39) H63Q possibly damaging Het
Zkscan6 C A 11: 65,712,817 (GRCm39) T250N probably damaging Het
Zmat2 A T 18: 36,930,958 (GRCm39) K161N possibly damaging Het
Zyg11a A G 4: 108,062,420 (GRCm39) L127P probably damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 39,036,398 (GRCm39) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,943,188 (GRCm39) missense probably damaging 1.00
IGL00698:Fat4 APN 3 39,035,294 (GRCm39) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,944,822 (GRCm39) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,944,728 (GRCm39) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 39,011,418 (GRCm39) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,061,350 (GRCm39) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 39,034,807 (GRCm39) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,944,140 (GRCm39) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,941,647 (GRCm39) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,945,330 (GRCm39) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,942,219 (GRCm39) missense probably damaging 1.00
IGL01514:Fat4 APN 3 39,003,683 (GRCm39) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,063,406 (GRCm39) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,941,907 (GRCm39) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,943,096 (GRCm39) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,064,524 (GRCm39) nonsense probably null
IGL01626:Fat4 APN 3 39,005,181 (GRCm39) missense probably damaging 1.00
IGL01746:Fat4 APN 3 39,045,880 (GRCm39) nonsense probably null
IGL01800:Fat4 APN 3 39,035,878 (GRCm39) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,942,922 (GRCm39) missense probably damaging 1.00
IGL01863:Fat4 APN 3 39,024,768 (GRCm39) splice site probably benign
IGL01917:Fat4 APN 3 38,943,879 (GRCm39) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 39,033,923 (GRCm39) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,064,420 (GRCm39) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,943,348 (GRCm39) missense probably damaging 0.97
IGL02119:Fat4 APN 3 39,037,088 (GRCm39) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,942,553 (GRCm39) missense probably damaging 1.00
IGL02164:Fat4 APN 3 39,050,354 (GRCm39) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,944,695 (GRCm39) missense probably damaging 1.00
IGL02207:Fat4 APN 3 39,005,412 (GRCm39) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,946,002 (GRCm39) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,055,288 (GRCm39) missense probably benign 0.09
IGL02271:Fat4 APN 3 39,034,068 (GRCm39) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,064,137 (GRCm39) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,941,779 (GRCm39) missense probably damaging 1.00
IGL02455:Fat4 APN 3 39,005,280 (GRCm39) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 39,037,195 (GRCm39) missense probably benign
IGL02478:Fat4 APN 3 38,942,364 (GRCm39) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,064,579 (GRCm39) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,941,394 (GRCm39) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,056,913 (GRCm39) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,056,985 (GRCm39) missense probably benign 0.08
IGL02674:Fat4 APN 3 39,037,486 (GRCm39) missense probably benign 0.35
IGL02692:Fat4 APN 3 39,005,235 (GRCm39) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,944,744 (GRCm39) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,943,444 (GRCm39) missense probably damaging 1.00
IGL02834:Fat4 APN 3 39,010,893 (GRCm39) missense probably damaging 1.00
IGL02891:Fat4 APN 3 39,005,422 (GRCm39) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,944,992 (GRCm39) missense probably damaging 1.00
IGL02993:Fat4 APN 3 39,011,304 (GRCm39) missense probably damaging 1.00
IGL02996:Fat4 APN 3 39,012,674 (GRCm39) missense probably damaging 1.00
IGL03029:Fat4 APN 3 39,036,740 (GRCm39) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 39,035,701 (GRCm39) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 39,011,008 (GRCm39) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 39,045,834 (GRCm39) missense probably damaging 1.00
IGL03169:Fat4 APN 3 39,011,547 (GRCm39) missense probably benign 0.02
IGL03190:Fat4 APN 3 39,035,390 (GRCm39) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,063,852 (GRCm39) missense probably benign
IGL03371:Fat4 APN 3 39,037,336 (GRCm39) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,943,283 (GRCm39) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 39,011,376 (GRCm39) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,946,168 (GRCm39) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,063,513 (GRCm39) missense probably damaging 1.00
IGL03405:Fat4 APN 3 39,012,599 (GRCm39) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,945,325 (GRCm39) missense probably damaging 1.00
Asahi UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
Expulsion UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
heineken UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
schlitz UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 39,036,506 (GRCm39) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,943,153 (GRCm39) missense probably benign 0.04
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,943,080 (GRCm39) missense probably benign 0.35
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,945,745 (GRCm39) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,944,965 (GRCm39) missense probably benign
R0357:Fat4 UTSW 3 38,945,376 (GRCm39) missense probably damaging 1.00
R0409:Fat4 UTSW 3 39,031,562 (GRCm39) missense probably damaging 1.00
R0498:Fat4 UTSW 3 39,034,786 (GRCm39) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,057,073 (GRCm39) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,942,463 (GRCm39) missense probably benign 0.00
R0532:Fat4 UTSW 3 39,035,870 (GRCm39) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,997,019 (GRCm39) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,054,321 (GRCm39) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,943,843 (GRCm39) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,055,327 (GRCm39) missense probably benign
R0729:Fat4 UTSW 3 39,054,444 (GRCm39) splice site probably benign
R0748:Fat4 UTSW 3 38,941,977 (GRCm39) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0812:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0830:Fat4 UTSW 3 39,053,258 (GRCm39) missense probably benign 0.26
R0841:Fat4 UTSW 3 39,050,147 (GRCm39) missense probably damaging 0.99
R0884:Fat4 UTSW 3 39,037,007 (GRCm39) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,945,541 (GRCm39) missense probably damaging 1.00
R1066:Fat4 UTSW 3 39,011,376 (GRCm39) missense probably damaging 1.00
R1078:Fat4 UTSW 3 39,037,235 (GRCm39) missense probably benign 0.10
R1084:Fat4 UTSW 3 39,033,974 (GRCm39) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 39,037,091 (GRCm39) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,944,520 (GRCm39) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,944,962 (GRCm39) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,942,472 (GRCm39) missense probably damaging 1.00
R1487:Fat4 UTSW 3 39,050,066 (GRCm39) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 39,037,225 (GRCm39) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,944,238 (GRCm39) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,943,135 (GRCm39) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,943,009 (GRCm39) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,061,326 (GRCm39) missense probably damaging 0.99
R1655:Fat4 UTSW 3 39,011,467 (GRCm39) missense probably damaging 0.97
R1662:Fat4 UTSW 3 39,034,928 (GRCm39) missense probably damaging 1.00
R1710:Fat4 UTSW 3 39,005,304 (GRCm39) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,945,459 (GRCm39) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,941,638 (GRCm39) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,064,417 (GRCm39) missense probably damaging 1.00
R1828:Fat4 UTSW 3 39,037,607 (GRCm39) missense probably damaging 1.00
R1835:Fat4 UTSW 3 39,037,720 (GRCm39) missense probably benign 0.00
R1846:Fat4 UTSW 3 39,036,532 (GRCm39) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,064,633 (GRCm39) missense probably benign 0.09
R1871:Fat4 UTSW 3 39,035,221 (GRCm39) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 39,045,813 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 39,050,239 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,941,264 (GRCm39) missense probably benign
R2056:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,064,804 (GRCm39) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,943,822 (GRCm39) missense probably damaging 1.00
R2114:Fat4 UTSW 3 39,035,633 (GRCm39) missense probably benign 0.01
R2135:Fat4 UTSW 3 39,034,882 (GRCm39) missense probably damaging 0.98
R2152:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2153:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,941,688 (GRCm39) missense probably damaging 1.00
R2196:Fat4 UTSW 3 39,035,566 (GRCm39) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,945,676 (GRCm39) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,064,364 (GRCm39) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,946,198 (GRCm39) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,943,138 (GRCm39) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,944,571 (GRCm39) missense probably benign 0.25
R2274:Fat4 UTSW 3 39,050,048 (GRCm39) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 39,034,160 (GRCm39) missense probably damaging 1.00
R2343:Fat4 UTSW 3 39,011,254 (GRCm39) missense probably damaging 0.97
R2365:Fat4 UTSW 3 39,034,568 (GRCm39) missense probably benign
R2412:Fat4 UTSW 3 39,011,221 (GRCm39) missense probably benign 0.05
R2883:Fat4 UTSW 3 39,034,953 (GRCm39) missense probably damaging 1.00
R2942:Fat4 UTSW 3 39,036,485 (GRCm39) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,061,302 (GRCm39) missense probably benign
R3103:Fat4 UTSW 3 38,946,089 (GRCm39) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,944,940 (GRCm39) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 39,035,423 (GRCm39) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 39,036,587 (GRCm39) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3957:Fat4 UTSW 3 39,036,495 (GRCm39) missense probably benign
R4065:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign 0.13
R4078:Fat4 UTSW 3 39,034,169 (GRCm39) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,942,024 (GRCm39) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,996,958 (GRCm39) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,943,320 (GRCm39) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,945,912 (GRCm39) missense probably damaging 1.00
R4407:Fat4 UTSW 3 39,012,689 (GRCm39) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,945,443 (GRCm39) missense probably benign 0.01
R4547:Fat4 UTSW 3 39,005,432 (GRCm39) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,941,491 (GRCm39) missense probably damaging 1.00
R4826:Fat4 UTSW 3 39,037,106 (GRCm39) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,942,466 (GRCm39) missense probably benign
R4871:Fat4 UTSW 3 38,945,754 (GRCm39) missense probably damaging 1.00
R4897:Fat4 UTSW 3 39,034,781 (GRCm39) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,064,614 (GRCm39) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,061,352 (GRCm39) missense probably benign 0.00
R4941:Fat4 UTSW 3 39,011,601 (GRCm39) missense probably damaging 1.00
R4943:Fat4 UTSW 3 39,034,322 (GRCm39) missense probably benign 0.19
R4959:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R4973:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,942,438 (GRCm39) missense probably benign 0.34
R5163:Fat4 UTSW 3 39,034,946 (GRCm39) missense probably damaging 1.00
R5213:Fat4 UTSW 3 39,034,340 (GRCm39) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 39,011,017 (GRCm39) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,064,527 (GRCm39) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,942,154 (GRCm39) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,943,013 (GRCm39) missense probably damaging 1.00
R5384:Fat4 UTSW 3 39,050,095 (GRCm39) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,941,394 (GRCm39) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,945,495 (GRCm39) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,064,519 (GRCm39) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,941,364 (GRCm39) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,064,423 (GRCm39) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,943,083 (GRCm39) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,057,117 (GRCm39) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,943,774 (GRCm39) missense probably damaging 1.00
R5735:Fat4 UTSW 3 39,003,725 (GRCm39) missense probably damaging 1.00
R5739:Fat4 UTSW 3 39,037,283 (GRCm39) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,943,617 (GRCm39) missense probably damaging 1.00
R5780:Fat4 UTSW 3 39,035,104 (GRCm39) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,945,936 (GRCm39) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,061,454 (GRCm39) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,941,485 (GRCm39) missense probably benign
R5933:Fat4 UTSW 3 39,005,524 (GRCm39) critical splice donor site probably null
R5938:Fat4 UTSW 3 39,005,388 (GRCm39) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
R5945:Fat4 UTSW 3 39,037,355 (GRCm39) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,064,696 (GRCm39) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,056,951 (GRCm39) missense probably damaging 1.00
R6158:Fat4 UTSW 3 39,037,411 (GRCm39) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 1.00
R6253:Fat4 UTSW 3 39,005,505 (GRCm39) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,061,395 (GRCm39) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,061,229 (GRCm39) splice site probably null
R6387:Fat4 UTSW 3 39,037,934 (GRCm39) missense probably damaging 1.00
R6390:Fat4 UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
R6456:Fat4 UTSW 3 39,038,128 (GRCm39) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,945,036 (GRCm39) missense probably damaging 1.00
R6500:Fat4 UTSW 3 39,035,418 (GRCm39) nonsense probably null
R6503:Fat4 UTSW 3 39,036,406 (GRCm39) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,057,020 (GRCm39) missense probably benign
R6566:Fat4 UTSW 3 39,011,275 (GRCm39) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 39,033,839 (GRCm39) missense probably benign
R6590:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,997,077 (GRCm39) missense probably benign 0.01
R6662:Fat4 UTSW 3 39,010,970 (GRCm39) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6807:Fat4 UTSW 3 39,036,589 (GRCm39) missense probably benign 0.18
R6823:Fat4 UTSW 3 39,038,088 (GRCm39) missense probably benign 0.05
R6824:Fat4 UTSW 3 39,011,674 (GRCm39) missense probably benign 0.00
R6830:Fat4 UTSW 3 39,035,966 (GRCm39) missense probably benign 0.00
R6925:Fat4 UTSW 3 39,050,353 (GRCm39) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,063,595 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,050,120 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,035,924 (GRCm39) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,945,692 (GRCm39) missense probably benign
R7030:Fat4 UTSW 3 39,036,107 (GRCm39) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,064,960 (GRCm39) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,064,959 (GRCm39) missense probably benign
R7045:Fat4 UTSW 3 38,942,750 (GRCm39) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,944,023 (GRCm39) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,064,682 (GRCm39) missense probably damaging 1.00
R7130:Fat4 UTSW 3 39,034,936 (GRCm39) missense probably damaging 0.99
R7168:Fat4 UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
R7192:Fat4 UTSW 3 39,034,613 (GRCm39) missense probably benign 0.04
R7194:Fat4 UTSW 3 39,038,044 (GRCm39) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,943,033 (GRCm39) missense probably damaging 1.00
R7199:Fat4 UTSW 3 39,031,511 (GRCm39) missense probably damaging 0.98
R7213:Fat4 UTSW 3 39,053,236 (GRCm39) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,945,192 (GRCm39) missense probably damaging 1.00
R7225:Fat4 UTSW 3 39,034,325 (GRCm39) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,944,562 (GRCm39) missense probably benign 0.31
R7239:Fat4 UTSW 3 39,037,989 (GRCm39) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,943,842 (GRCm39) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,943,294 (GRCm39) nonsense probably null
R7372:Fat4 UTSW 3 38,944,358 (GRCm39) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,942,073 (GRCm39) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,054,385 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,063,793 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,941,599 (GRCm39) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,063,306 (GRCm39) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 39,011,576 (GRCm39) nonsense probably null
R7501:Fat4 UTSW 3 39,012,597 (GRCm39) nonsense probably null
R7533:Fat4 UTSW 3 39,061,406 (GRCm39) missense probably benign 0.43
R7542:Fat4 UTSW 3 39,035,770 (GRCm39) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 39,035,504 (GRCm39) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 39,035,263 (GRCm39) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,943,485 (GRCm39) missense probably damaging 1.00
R7644:Fat4 UTSW 3 39,064,390 (GRCm39) missense possibly damaging 0.64
R7660:Fat4 UTSW 3 39,035,309 (GRCm39) missense probably benign
R7665:Fat4 UTSW 3 38,943,327 (GRCm39) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,945,846 (GRCm39) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,055,353 (GRCm39) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,942,000 (GRCm39) missense probably benign
R7883:Fat4 UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
R7892:Fat4 UTSW 3 39,003,588 (GRCm39) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,941,690 (GRCm39) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 0.98
R8015:Fat4 UTSW 3 39,036,065 (GRCm39) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 39,035,815 (GRCm39) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,945,352 (GRCm39) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,946,203 (GRCm39) missense probably damaging 0.99
R8163:Fat4 UTSW 3 39,033,881 (GRCm39) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 39,012,659 (GRCm39) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,063,128 (GRCm39) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 39,033,824 (GRCm39) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 39,035,702 (GRCm39) missense probably benign 0.25
R8509:Fat4 UTSW 3 39,036,052 (GRCm39) missense probably benign
R8543:Fat4 UTSW 3 39,031,643 (GRCm39) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,064,842 (GRCm39) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,064,647 (GRCm39) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,942,592 (GRCm39) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,946,002 (GRCm39) missense probably benign 0.01
R8779:Fat4 UTSW 3 39,033,898 (GRCm39) missense probably damaging 1.00
R8797:Fat4 UTSW 3 39,053,278 (GRCm39) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,946,269 (GRCm39) missense probably benign 0.26
R8955:Fat4 UTSW 3 39,037,778 (GRCm39) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,941,324 (GRCm39) nonsense probably null
R9071:Fat4 UTSW 3 39,037,598 (GRCm39) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,061,448 (GRCm39) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,064,803 (GRCm39) missense
R9180:Fat4 UTSW 3 38,942,556 (GRCm39) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 39,036,592 (GRCm39) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,945,079 (GRCm39) missense probably damaging 1.00
R9206:Fat4 UTSW 3 39,063,390 (GRCm39) missense probably damaging 0.99
R9268:Fat4 UTSW 3 38,942,396 (GRCm39) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,945,171 (GRCm39) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,945,781 (GRCm39) missense probably damaging 0.98
R9355:Fat4 UTSW 3 39,036,047 (GRCm39) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,945,417 (GRCm39) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,945,412 (GRCm39) missense
R9456:Fat4 UTSW 3 38,942,571 (GRCm39) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9510:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9540:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign
R9568:Fat4 UTSW 3 38,946,156 (GRCm39) missense probably damaging 1.00
R9646:Fat4 UTSW 3 39,035,813 (GRCm39) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,943,332 (GRCm39) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,055,374 (GRCm39) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,063,255 (GRCm39) missense probably benign 0.00
X0019:Fat4 UTSW 3 39,035,189 (GRCm39) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,054,300 (GRCm39) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,997,051 (GRCm39) missense probably benign 0.43
X0064:Fat4 UTSW 3 39,024,901 (GRCm39) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 39,012,641 (GRCm39) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,941,199 (GRCm39) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 39,037,964 (GRCm39) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 39,037,508 (GRCm39) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,944,496 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,942,733 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 39,035,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCACCTCCGTAAAAGTG -3'
(R):5'- GCTCAGGAAGTTCAGGGCAATC -3'

Sequencing Primer
(F):5'- GAGCACCTCCGTAAAAGTGATCATC -3'
(R):5'- ATAAGAGGGTCTGCTAAATCTTGG -3'
Posted On 2022-07-18