Incidental Mutation 'R9511:Alg9'
ID 718174
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Name asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
Synonyms B430313H07Rik, 8230402H15Rik, Dibd1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 50775019-50843542 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 50806225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 436 (Y436S)
Ref Sequence ENSEMBL: ENSMUSP00000034561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000162073] [ENSMUST00000177320]
AlphaFold Q8VDI9
Predicted Effect probably damaging
Transcript: ENSMUST00000034561
AA Change: Y436S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: Y436S

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162073
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175728
Predicted Effect probably damaging
Transcript: ENSMUST00000177320
AA Change: Y53S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134818
Gene: ENSMUSG00000032059
AA Change: Y53S

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 2 99 4.3e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Abca13 T A 11: 9,328,130 S3103R probably benign Het
Ankar G A 1: 72,680,002 R563C probably benign Het
Ankrd34a C A 3: 96,598,085 R202S probably benign Het
Art4 T A 6: 136,854,615 N176I possibly damaging Het
Bivm A G 1: 44,143,090 E486G possibly damaging Het
Ccdc3 C A 2: 5,138,279 Q116K probably damaging Het
Cdc42bpb G A 12: 111,294,938 P1656S probably benign Het
Cdh6 T C 15: 13,034,591 D661G probably damaging Het
Chek1 T C 9: 36,713,451 N368S probably benign Het
Dnah11 A T 12: 117,914,617 F3924L probably damaging Het
Dusp7 T C 9: 106,370,926 I251T probably damaging Het
Dysf T A 6: 84,113,668 W988R probably damaging Het
Dzip1l T C 9: 99,637,657 V79A possibly damaging Het
Ebf1 A G 11: 44,924,566 I344V probably benign Het
Ern2 T C 7: 122,177,600 E336G probably benign Het
Fat4 T C 3: 38,980,653 L2818P probably damaging Het
Gjb3 T C 4: 127,326,338 S134G probably damaging Het
Gm10647 T C 9: 66,798,474 F108L unknown Het
Gm19410 A T 8: 35,790,694 D762V probably damaging Het
Gm8251 T G 1: 44,059,694 D748A probably benign Het
Gper1 A G 5: 139,426,383 K161R probably benign Het
Grin1 A G 2: 25,297,414 M628T probably damaging Het
Gsdmc A T 15: 63,778,048 D331E probably benign Het
Haus3 C A 5: 34,168,227 W29C probably damaging Het
Il10ra T C 9: 45,256,392 E289G probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnma1 T C 14: 23,311,725 T1133A possibly damaging Het
Ksr1 G A 11: 79,033,268 T458M possibly damaging Het
Mc5r T A 18: 68,339,494 M308K possibly damaging Het
Mis18a T C 16: 90,721,637 S146G possibly damaging Het
Mrpl50 G A 4: 49,514,501 R57* probably null Het
Mtfmt C T 9: 65,435,865 R18C probably benign Het
Nanos1 T A 19: 60,756,975 I237N probably damaging Het
Ncor1 TGC TGCGGC 11: 62,433,623 probably benign Het
Ndst3 T A 3: 123,606,906 E450D probably damaging Het
Nek10 C A 14: 14,828,511 T111K probably benign Het
Nipal2 T C 15: 34,584,687 Y245C probably damaging Het
Npat T A 9: 53,562,106 D399E probably benign Het
Olfr1454 T C 19: 13,063,755 S115P probably damaging Het
Opa1 A G 16: 29,610,920 S378G probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pex16 A T 2: 92,379,214 probably null Het
Plec A T 15: 76,174,697 I3680N probably damaging Het
Plin3 A T 17: 56,284,225 V185E probably damaging Het
Prex1 T A 2: 166,571,561 D1512V probably damaging Het
Ptpn22 T A 3: 103,885,597 S355T probably benign Het
Scn5a A G 9: 119,522,545 I790T probably benign Het
Sema6d T C 2: 124,658,023 F340L probably damaging Het
Sh2b1 AGCTC AGCTCCGCCACGGGGACCCGCTC 7: 126,467,578 probably benign Het
Slc22a2 A G 17: 12,610,029 T341A probably damaging Het
Slc6a6 T C 6: 91,744,940 Y374H probably damaging Het
Slitrk3 T G 3: 73,050,939 S167R possibly damaging Het
Smchd1 G A 17: 71,443,904 H340Y possibly damaging Het
Sorcs1 C T 19: 50,678,083 R129Q probably benign Het
Sox9 A G 11: 112,785,175 T397A possibly damaging Het
Tnpo1 C A 13: 98,867,113 R245L possibly damaging Het
Traip T A 9: 107,961,586 M183K probably damaging Het
Trpc6 A T 9: 8,680,418 E882D probably benign Het
Uba6 C A 5: 86,140,360 G491V probably damaging Het
Uqcrfs1 A T 13: 30,545,054 V65E probably benign Het
Urgcp T C 11: 5,718,128 D113G probably damaging Het
Wdr76 C T 2: 121,542,495 T503M probably damaging Het
Zfp27 T C 7: 29,894,216 T775A possibly damaging Het
Zfp518b A T 5: 38,672,052 V870E possibly damaging Het
Zfp932 T A 5: 110,007,311 H63Q possibly damaging Het
Zkscan6 C A 11: 65,821,991 T250N probably damaging Het
Zmat2 A T 18: 36,797,905 K161N possibly damaging Het
Zyg11a A G 4: 108,205,223 L127P probably damaging Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R1837:Alg9 UTSW 9 50806315 missense probably damaging 1.00
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5053:Alg9 UTSW 9 50788172 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50789535 missense probably benign
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7829:Alg9 UTSW 9 50788171 missense probably damaging 1.00
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
R9214:Alg9 UTSW 9 50806245 missense probably damaging 1.00
R9497:Alg9 UTSW 9 50800136 missense probably damaging 0.97
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAATGCAATGAAGCCGAAATATG -3'
(R):5'- ATGAGAGAGGAGAGCCATTTCC -3'

Sequencing Primer
(F):5'- TGGAGTCATAATACTAAAACATGCCC -3'
(R):5'- AGAGGAGAGCCATTTCCTTTTTATGC -3'
Posted On 2022-07-18