Mutagenetix > Incidental Mutation

Incidental Mutation 'R9512:Slc9a2'

718210

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R9512 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 40682098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 75 (D75E)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: D75E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: D75E

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192345
AA Change: D75E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: D75E

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	C	T	7: 120,423,740	A33V	probably benign	Het
Abcb9	T	C	5: 124,090,113	T22A	possibly damaging	Het
Alkbh8	G	T	9: 3,367,959	R325M	probably damaging	Het
Ap1g1	T	C	8: 109,803,055	S36P	probably damaging	Het
Arid1b	A	G	17: 5,341,589	D1745G	probably benign	Het
Bnipl	A	G	3: 95,243,058	V292A	probably benign	Het
Brca2	C	T	5: 150,531,081	A103V	probably benign	Het
Capn3	G	A	2: 120,496,054	E576K	probably damaging	Het
Eif2ak4	G	A	2: 118,462,715	G1372S	probably damaging	Het
Ephb6	G	A	6: 41,616,096	E423K	possibly damaging	Het
Esrp1	A	G	4: 11,365,449	V213A	probably benign	Het
Fndc3a	T	C	14: 72,589,984	E87G	probably damaging	Het
Foxn1	G	T	11: 78,371,209	S111R		Het
Fyb2	G	A	4: 104,995,903	R564Q	probably benign	Het
Gm4969	T	A	7: 19,104,935	T156S	unknown	Het
Henmt1	A	G	3: 108,960,129	I327V	probably benign	Het
Hsdl2	A	T	4: 59,594,464	R117*	probably null	Het
Kif18a	A	G	2: 109,341,172	T865A	probably benign	Het
Lrrcc1	T	C	3: 14,548,241	L463P	possibly damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Mroh4	C	A	15: 74,613,246	R539L	probably benign	Het
Nln	A	T	13: 104,061,766	H179Q	possibly damaging	Het
Nrg2	A	G	18: 36,045,957	F309L	probably benign	Het
Ntng2	T	C	2: 29,227,957	T160A	possibly damaging	Het
Olfr1267-ps1	A	G	2: 90,086,377	L28P	possibly damaging	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Olfr1410	T	C	1: 92,608,268	C144R	probably benign	Het
Olfr338	T	C	2: 36,377,313	L179P	possibly damaging	Het
Orc6	T	A	8: 85,302,893	I98N		Het
Pcdha8	A	C	18: 36,993,571	I369L	possibly damaging	Het
Plk2	C	T	13: 110,400,139	T655M	probably damaging	Het
Pou1f1	A	G	16: 65,523,616	T66A	probably benign	Het
Ppp1r9a	T	C	6: 5,115,364	V829A	probably damaging	Het
Ppp1r9a	A	T	6: 5,113,681	E728D	probably benign	Het
Psd	T	C	19: 46,317,715	K46R	possibly damaging	Het
Slc25a51	T	C	4: 45,399,360	I277V	probably benign	Het
Slitrk5	A	G	14: 111,679,820	Y292C	probably damaging	Het
Snap91	T	G	9: 86,783,339	T667P	unknown	Het
Spata16	G	C	3: 26,667,944	E205Q	possibly damaging	Het
Stard6	G	A	18: 70,500,530	V203I	probably benign	Het
Stra8	G	A	6: 34,933,053	A137T	probably benign	Het
Toporsl	A	G	4: 52,610,382	T92A	probably benign	Het
Ush2a	A	G	1: 188,910,963	N4174S	probably damaging	Het
Vmn1r232	A	C	17: 20,914,154	S61R	probably damaging	Het
Zfp263	T	C	16: 3,746,442	S199P	probably damaging	Het
Zfp616	G	A	11: 74,085,110	C735Y	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTTAGTAGTGCTGTCCCTCC -3'
(R):5'- GGCCACTATCTGAGACCAAC -3'

Sequencing Primer
(F):5'- TGCTGCGCTCATAGCTG -3'
(R):5'- GAGACCAACTACTTGCCTACTTGG -3'

Posted On

2022-07-18