Incidental Mutation 'R9512:Slc9a2'
ID 718210
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, 4932415O19Rik, NHE2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9512 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 40680574-40769273 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 40682098 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 75 (D75E)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
AlphaFold Q3ZAS0
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: D75E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: D75E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192345
AA Change: D75E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: D75E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,423,740 A33V probably benign Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Alkbh8 G T 9: 3,367,959 R325M probably damaging Het
Ap1g1 T C 8: 109,803,055 S36P probably damaging Het
Arid1b A G 17: 5,341,589 D1745G probably benign Het
Bnipl A G 3: 95,243,058 V292A probably benign Het
Brca2 C T 5: 150,531,081 A103V probably benign Het
Capn3 G A 2: 120,496,054 E576K probably damaging Het
Eif2ak4 G A 2: 118,462,715 G1372S probably damaging Het
Ephb6 G A 6: 41,616,096 E423K possibly damaging Het
Esrp1 A G 4: 11,365,449 V213A probably benign Het
Fndc3a T C 14: 72,589,984 E87G probably damaging Het
Foxn1 G T 11: 78,371,209 S111R Het
Fyb2 G A 4: 104,995,903 R564Q probably benign Het
Gm4969 T A 7: 19,104,935 T156S unknown Het
Henmt1 A G 3: 108,960,129 I327V probably benign Het
Hsdl2 A T 4: 59,594,464 R117* probably null Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Lrrcc1 T C 3: 14,548,241 L463P possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mroh4 C A 15: 74,613,246 R539L probably benign Het
Nln A T 13: 104,061,766 H179Q possibly damaging Het
Nrg2 A G 18: 36,045,957 F309L probably benign Het
Ntng2 T C 2: 29,227,957 T160A possibly damaging Het
Olfr1267-ps1 A G 2: 90,086,377 L28P possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1410 T C 1: 92,608,268 C144R probably benign Het
Olfr338 T C 2: 36,377,313 L179P possibly damaging Het
Orc6 T A 8: 85,302,893 I98N Het
Pcdha8 A C 18: 36,993,571 I369L possibly damaging Het
Plk2 C T 13: 110,400,139 T655M probably damaging Het
Pou1f1 A G 16: 65,523,616 T66A probably benign Het
Ppp1r9a A T 6: 5,113,681 E728D probably benign Het
Ppp1r9a T C 6: 5,115,364 V829A probably damaging Het
Psd T C 19: 46,317,715 K46R possibly damaging Het
Slc25a51 T C 4: 45,399,360 I277V probably benign Het
Slitrk5 A G 14: 111,679,820 Y292C probably damaging Het
Snap91 T G 9: 86,783,339 T667P unknown Het
Spata16 G C 3: 26,667,944 E205Q possibly damaging Het
Stard6 G A 18: 70,500,530 V203I probably benign Het
Stra8 G A 6: 34,933,053 A137T probably benign Het
Toporsl A G 4: 52,610,382 T92A probably benign Het
Ush2a A G 1: 188,910,963 N4174S probably damaging Het
Vmn1r232 A C 17: 20,914,154 S61R probably damaging Het
Zfp263 T C 16: 3,746,442 S199P probably damaging Het
Zfp616 G A 11: 74,085,110 C735Y probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
putty UTSW 1 40742653 nonsense probably null
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7670:Slc9a2 UTSW 1 40718997 missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40726214 missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8887:Slc9a2 UTSW 1 40718849 missense probably benign 0.01
R9028:Slc9a2 UTSW 1 40726452 missense probably damaging 1.00
R9189:Slc9a2 UTSW 1 40755784 missense probably benign 0.21
R9245:Slc9a2 UTSW 1 40766300 missense probably benign 0.27
R9250:Slc9a2 UTSW 1 40767827 missense probably benign 0.00
R9400:Slc9a2 UTSW 1 40719051 missense possibly damaging 0.65
R9583:Slc9a2 UTSW 1 40681901 missense probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTAGTAGTGCTGTCCCTCC -3'
(R):5'- GGCCACTATCTGAGACCAAC -3'

Sequencing Primer
(F):5'- TGCTGCGCTCATAGCTG -3'
(R):5'- GAGACCAACTACTTGCCTACTTGG -3'
Posted On 2022-07-18