Incidental Mutation 'R9512:Esrp1'
ID 718223
Institutional Source Beutler Lab
Gene Symbol Esrp1
Ensembl Gene ENSMUSG00000040728
Gene Name epithelial splicing regulatory protein 1
Synonyms 2210008M09Rik, Rbm35a
Accession Numbers

Genbank: NM_194055; MGI: 1917326

Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R9512 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 11331933-11386783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11365449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 213 (V213A)
Ref Sequence ENSEMBL: ENSMUSP00000119598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043781] [ENSMUST00000108310] [ENSMUST00000108311] [ENSMUST00000108313] [ENSMUST00000147342] [ENSMUST00000155519]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000043781
AA Change: V227A

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037921
Gene: ENSMUSG00000040728
AA Change: V227A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108310
AA Change: V227A

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103946
Gene: ENSMUSG00000040728
AA Change: V227A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108311
AA Change: V227A

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103947
Gene: ENSMUSG00000040728
AA Change: V227A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108313
AA Change: V227A

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103949
Gene: ENSMUSG00000040728
AA Change: V227A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147342
AA Change: V62A

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121117
Gene: ENSMUSG00000040728
AA Change: V62A

DomainStartEndE-ValueType
RRM 61 133 2.6e-2 SMART
RRM 162 237 1.75e-5 SMART
low complexity region 255 269 N/A INTRINSIC
RRM 281 356 1.03e-2 SMART
low complexity region 377 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155519
AA Change: V213A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119598
Gene: ENSMUSG00000040728
AA Change: V213A

DomainStartEndE-ValueType
RRM 212 284 2.6e-2 SMART
RRM 313 388 1.75e-5 SMART
low complexity region 406 420 N/A INTRINSIC
Blast:RRM 432 472 7e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR1 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit hyperactivity and circling with no detectable hearing deficits. Mice homozygous for a null allele exhibit bilateral cleft lip and cleft palate, and die at P0. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,423,740 A33V probably benign Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Alkbh8 G T 9: 3,367,959 R325M probably damaging Het
Ap1g1 T C 8: 109,803,055 S36P probably damaging Het
Arid1b A G 17: 5,341,589 D1745G probably benign Het
Bnipl A G 3: 95,243,058 V292A probably benign Het
Brca2 C T 5: 150,531,081 A103V probably benign Het
Capn3 G A 2: 120,496,054 E576K probably damaging Het
Eif2ak4 G A 2: 118,462,715 G1372S probably damaging Het
Ephb6 G A 6: 41,616,096 E423K possibly damaging Het
Fndc3a T C 14: 72,589,984 E87G probably damaging Het
Foxn1 G T 11: 78,371,209 S111R Het
Fyb2 G A 4: 104,995,903 R564Q probably benign Het
Gm4969 T A 7: 19,104,935 T156S unknown Het
Henmt1 A G 3: 108,960,129 I327V probably benign Het
Hsdl2 A T 4: 59,594,464 R117* probably null Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Lrrcc1 T C 3: 14,548,241 L463P possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mroh4 C A 15: 74,613,246 R539L probably benign Het
Nln A T 13: 104,061,766 H179Q possibly damaging Het
Nrg2 A G 18: 36,045,957 F309L probably benign Het
Ntng2 T C 2: 29,227,957 T160A possibly damaging Het
Olfr1267-ps1 A G 2: 90,086,377 L28P possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1410 T C 1: 92,608,268 C144R probably benign Het
Olfr338 T C 2: 36,377,313 L179P possibly damaging Het
Orc6 T A 8: 85,302,893 I98N Het
Pcdha8 A C 18: 36,993,571 I369L possibly damaging Het
Plk2 C T 13: 110,400,139 T655M probably damaging Het
Pou1f1 A G 16: 65,523,616 T66A probably benign Het
Ppp1r9a A T 6: 5,113,681 E728D probably benign Het
Ppp1r9a T C 6: 5,115,364 V829A probably damaging Het
Psd T C 19: 46,317,715 K46R possibly damaging Het
Slc25a51 T C 4: 45,399,360 I277V probably benign Het
Slc9a2 T G 1: 40,682,098 D75E probably damaging Het
Slitrk5 A G 14: 111,679,820 Y292C probably damaging Het
Snap91 T G 9: 86,783,339 T667P unknown Het
Spata16 G C 3: 26,667,944 E205Q possibly damaging Het
Stard6 G A 18: 70,500,530 V203I probably benign Het
Stra8 G A 6: 34,933,053 A137T probably benign Het
Toporsl A G 4: 52,610,382 T92A probably benign Het
Ush2a A G 1: 188,910,963 N4174S probably damaging Het
Vmn1r232 A C 17: 20,914,154 S61R probably damaging Het
Zfp263 T C 16: 3,746,442 S199P probably damaging Het
Zfp616 G A 11: 74,085,110 C735Y probably damaging Het
Other mutations in Esrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Esrp1 APN 4 11384374 missense possibly damaging 0.47
IGL02251:Esrp1 APN 4 11361202 missense probably damaging 1.00
IGL02669:Esrp1 APN 4 11386324 missense possibly damaging 0.61
Barley UTSW 4 11365205 missense probably damaging 1.00
korn UTSW 4 11357519 missense probably damaging 1.00
triaka UTSW 4 11379300 missense probably benign 0.01
R1109:Esrp1 UTSW 4 11365205 missense probably damaging 1.00
R1531:Esrp1 UTSW 4 11379375 missense probably damaging 0.99
R2189:Esrp1 UTSW 4 11357603 missense probably benign 0.04
R2255:Esrp1 UTSW 4 11365211 missense probably damaging 0.99
R5919:Esrp1 UTSW 4 11344146 missense probably damaging 0.96
R5924:Esrp1 UTSW 4 11361174 missense probably damaging 1.00
R6042:Esrp1 UTSW 4 11357580 missense possibly damaging 0.93
R6749:Esrp1 UTSW 4 11357519 missense probably damaging 1.00
R6817:Esrp1 UTSW 4 11357552 missense probably damaging 1.00
R7392:Esrp1 UTSW 4 11338809 missense probably benign 0.00
R7607:Esrp1 UTSW 4 11384449 missense probably damaging 0.99
R7985:Esrp1 UTSW 4 11367153 missense probably benign 0.17
R8050:Esrp1 UTSW 4 11338767 missense probably damaging 1.00
Z1176:Esrp1 UTSW 4 11384396 missense probably damaging 1.00
Z1176:Esrp1 UTSW 4 11385765 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GAGCATTCAGGCAAAGTGCTG -3'
(R):5'- CCATCATTCTAGAGTGACGCAG -3'

Sequencing Primer
(F):5'- TGCGCCACCCCTTTGAAAG -3'
(R):5'- GATTCTTTGAGCTGTCCGCAGAC -3'
Posted On 2022-07-18