Incidental Mutation 'R9513:Ephb4'
ID 718281
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, Myk1, Tyro11
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9513 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137350109-137378669 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137363302 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 531 (H531Q)
Ref Sequence ENSEMBL: ENSMUSP00000106684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect possibly damaging
Transcript: ENSMUST00000061244
AA Change: H522Q

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: H522Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111054
AA Change: H522Q

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: H522Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111055
AA Change: H531Q

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: H531Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144296
AA Change: H522Q

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: H522Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166239
AA Change: H522Q

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: H522Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810474O19Rik T A 6: 149,328,295 Y946* probably null Het
Accsl T C 2: 93,869,153 probably benign Het
Adgrv1 T A 13: 81,382,353 K5867N possibly damaging Het
Adh1 T A 3: 138,282,810 Y181* probably null Het
Agbl2 T C 2: 90,801,114 V272A possibly damaging Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Amotl1 A T 9: 14,614,767 S6T probably benign Het
Bicd1 T A 6: 149,512,893 V368E probably damaging Het
Brinp2 G A 1: 158,246,703 T616I probably damaging Het
C1rl T A 6: 124,508,843 V391E probably damaging Het
Cacna1e T A 1: 154,442,287 I1450F probably damaging Het
Camk2a A G 18: 60,955,535 probably null Het
Ccdc125 A G 13: 100,690,367 E244G probably benign Het
Cdh23 C T 10: 60,331,216 A1884T probably damaging Het
Clcn1 T C 6: 42,305,528 I510T probably damaging Het
Copb1 A T 7: 114,232,197 V572D probably benign Het
Ctf1 AGCAAC A 7: 127,717,008 probably null Het
Dnhd1 T A 7: 105,704,972 L3053Q probably damaging Het
Fam208a T A 14: 27,464,314 C823* probably null Het
Fgl2 T A 5: 21,375,792 C377* probably null Het
Frmd4a T C 2: 4,603,900 F860L probably damaging Het
Gbp9 T C 5: 105,081,225 N519D probably benign Het
Gm1110 A G 9: 26,883,787 S468P possibly damaging Het
Gm13128 T A 4: 144,333,108 I463N possibly damaging Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gnas T C 2: 174,343,296 Y916H probably damaging Het
Hectd1 T C 12: 51,769,296 D1336G possibly damaging Het
Herc2 G T 7: 56,113,100 G859V probably damaging Het
Hydin G A 8: 110,595,482 D4589N probably damaging Het
Itfg1 A T 8: 85,764,246 N351K possibly damaging Het
Kcnd3 G A 3: 105,665,547 probably null Het
Krt77 A T 15: 101,861,344 Y364N probably damaging Het
Lcn4 C T 2: 26,670,601 probably null Het
Lrrn1 T A 6: 107,568,544 H434Q probably benign Het
Lrrtm2 A G 18: 35,213,634 I205T probably damaging Het
Mepce G C 5: 137,785,497 P189R probably damaging Het
Mfap1a T C 2: 121,499,603 K221E probably benign Het
Myo7a A G 7: 98,097,611 probably null Het
Ncbp3 T C 11: 73,047,901 M1T probably null Het
Nck1 A T 9: 100,497,316 M294K probably benign Het
Nr2f2 A T 7: 70,360,308 W8R probably damaging Het
Olfr1062 A T 2: 86,423,363 F104L probably damaging Het
Olfr1145 T A 2: 87,809,843 S8T possibly damaging Het
Olfr1255 A T 2: 89,817,209 R288S probably damaging Het
Olfr1537 T C 9: 39,238,329 T32A probably benign Het
Olfr379-ps1 T A 11: 73,433,992 Q78L unknown Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr860 A G 9: 19,846,520 L33P possibly damaging Het
Pcdha1 A G 18: 36,932,233 K650R probably benign Het
Pgm2 T A 4: 99,984,045 I532N probably damaging Het
Pik3c2a T A 7: 116,340,086 K1672N probably benign Het
Pou3f1 G A 4: 124,659,042 G446S probably benign Het
Ppm1j T C 3: 104,785,818 I497T probably damaging Het
Pprc1 C T 19: 46,068,061 Q1202* probably null Het
Prdm15 T C 16: 97,806,504 N713S probably damaging Het
Ptprb A G 10: 116,302,237 T62A probably benign Het
Rabl2 T A 15: 89,590,428 probably null Het
Ranbp3l A T 15: 9,007,302 R149* probably null Het
Rfx4 T A 10: 84,838,186 M1K probably null Het
Ripk4 G T 16: 97,745,898 S388* probably null Het
Rnft1 T G 11: 86,486,239 I43R possibly damaging Het
Setbp1 A T 18: 78,856,566 F1295L probably damaging Het
Sez6 A G 11: 77,974,583 D682G probably damaging Het
Slc1a1 T C 19: 28,835,334 probably null Het
Slc7a5 G T 8: 121,886,877 T312K probably benign Het
Slco4c1 A T 1: 96,871,918 N64K probably benign Het
Spata13 C T 14: 60,692,400 T469I probably benign Het
Stxbp5 T A 10: 9,812,010 N440I probably benign Het
Tas2r114 T A 6: 131,689,783 Q94L probably benign Het
Tfr2 A G 5: 137,577,507 D295G possibly damaging Het
Thap7 A G 16: 17,530,288 Y60H probably damaging Het
Tjap1 G T 17: 46,258,807 P409H probably damaging Het
Tmtc4 G A 14: 122,971,792 A147V probably benign Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Tpra1 T C 6: 88,910,239 V193A probably benign Het
Trafd1 T C 5: 121,378,774 N122S possibly damaging Het
Vmn1r151 T A 7: 22,499,671 D3V probably benign Het
Wdr20rt A G 12: 65,226,051 Y96C probably damaging Het
Zfp507 A G 7: 35,776,148 V880A probably benign Het
Zfp598 A G 17: 24,677,594 D215G probably damaging Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Zfp738 A T 13: 67,669,516 C785* probably null Het
Zfp985 C T 4: 147,583,542 T289I probably damaging Het
Zkscan6 T A 11: 65,821,969 Y243N probably damaging Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137357855 missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137370805 missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137354562 missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137363267 missense probably damaging 0.99
R9659:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAATCTTACGGCCCATTCC -3'
(R):5'- TGCTCATCTTACTGGAGGAGG -3'

Sequencing Primer
(F):5'- GAATCTTACGGCCCATTCCTTTCTC -3'
(R):5'- CTTGTGGGTCAACATGCAGC -3'
Posted On 2022-07-18