Incidental Mutation 'R9514:Cfap65'
ID 718344
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74945468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably null
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,312,533 (GRCm39) S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Acsl6 A G 11: 54,225,880 (GRCm39) N307D probably benign Het
Atxn1 A G 13: 45,721,433 (GRCm39) V154A probably benign Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Cacna2d4 T C 6: 119,213,611 (GRCm39) L10S probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Cebpz A T 17: 79,239,684 (GRCm39) M579K probably benign Het
Cenpk T G 13: 104,370,682 (GRCm39) C103G probably benign Het
Cep97 T A 16: 55,726,093 (GRCm39) Q670L probably benign Het
Cir1 A G 2: 73,142,781 (GRCm39) S18P probably damaging Het
Coprs T C 8: 13,935,081 (GRCm39) Y158C probably damaging Het
Creld1 T C 6: 113,469,765 (GRCm39) F389S probably damaging Het
Dimt1 T C 13: 107,093,636 (GRCm39) I276T possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Dsp T A 13: 38,371,781 (GRCm39) C911S probably benign Het
Egr3 A G 14: 70,314,978 (GRCm39) I29V probably benign Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fam83a G A 15: 57,849,765 (GRCm39) G103D possibly damaging Het
Fat2 T A 11: 55,175,808 (GRCm39) Q1635L probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Fryl T C 5: 73,262,115 (GRCm39) K551E probably damaging Het
Galr2 A G 11: 116,174,452 (GRCm39) T361A probably benign Het
Gart A T 16: 91,427,596 (GRCm39) S467R probably benign Het
Ggps1 T C 13: 14,229,742 (GRCm39) K45R probably benign Het
Ghsr G C 3: 27,426,630 (GRCm39) V229L possibly damaging Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hectd2 A T 19: 36,582,689 (GRCm39) H473L possibly damaging Het
Hic2 T C 16: 17,076,293 (GRCm39) V374A possibly damaging Het
Hivep2 T A 10: 14,005,523 (GRCm39) I707N probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt34 A T 11: 99,929,226 (GRCm39) I328N probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lama2 T C 10: 27,100,015 (GRCm39) E830G probably benign Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Mau2 T C 8: 70,480,153 (GRCm39) Y318C probably damaging Het
Mier2 T C 10: 79,377,496 (GRCm39) S486G probably benign Het
Mllt10 A G 2: 18,164,322 (GRCm39) D284G probably damaging Het
Nbea A T 3: 55,937,366 (GRCm39) S748R probably damaging Het
Ncoa6 A G 2: 155,248,133 (GRCm39) S1724P probably benign Het
Nipal4 T A 11: 46,052,922 (GRCm39) probably null Het
Nlrc4 G C 17: 74,753,736 (GRCm39) L216V probably benign Het
Ogfr A G 2: 180,235,417 (GRCm39) M164V possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4b12 G A 2: 90,096,709 (GRCm39) Q22* probably null Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pkd1l3 T C 8: 110,395,849 (GRCm39) V2083A probably damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Prex1 C T 2: 166,419,896 (GRCm39) R1260Q possibly damaging Het
Prpf38b A G 3: 108,818,619 (GRCm39) V47A probably benign Het
Ptch1 T C 13: 63,675,071 (GRCm39) T851A probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Ptprm A G 17: 67,116,466 (GRCm39) Y938H probably damaging Het
R3hcc1l G A 19: 42,507,203 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,443,684 (GRCm39) V89A probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,066,770 (GRCm39) probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,066,750 (GRCm39) probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,066,765 (GRCm39) probably benign Het
Slain1 T A 14: 103,932,748 (GRCm39) V444E probably damaging Het
Slc10a5 T A 3: 10,400,532 (GRCm39) I43F possibly damaging Het
Smarca2 T C 19: 26,659,452 (GRCm39) F914S possibly damaging Het
Smarca5 A C 8: 81,428,840 (GRCm39) L1003V probably damaging Het
Spata18 A T 5: 73,829,840 (GRCm39) I332F Het
Spata31d1e A G 13: 59,890,806 (GRCm39) V338A probably damaging Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tktl2 C G 8: 66,965,840 (GRCm39) A466G probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tom1l2 T C 11: 60,153,486 (GRCm39) T164A probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Tpp2 T A 1: 44,017,648 (GRCm39) S751T probably benign Het
Trim11 G T 11: 58,878,477 (GRCm39) A251S unknown Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Trpm3 A G 19: 22,960,040 (GRCm39) N1225S probably benign Het
Usp21 T C 1: 171,112,503 (GRCm39) Y300C probably damaging Het
Usp32 T C 11: 84,913,560 (GRCm39) T924A probably damaging Het
Vmn1r198 A T 13: 22,539,015 (GRCm39) H167L possibly damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Zc3h8 T C 2: 128,773,223 (GRCm39) Y213C probably damaging Het
Zcchc17 A T 4: 130,232,337 (GRCm39) D55E probably benign Het
Zfp408 A T 2: 91,478,368 (GRCm39) W26R probably damaging Het
Zfp937 G T 2: 150,080,890 (GRCm39) A307S possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCCTGTGGATTTGGG -3'
(R):5'- TCTTCATGACCCCAAAGCTG -3'

Sequencing Primer
(F):5'- ATGCAGCAAGGTGGTCC -3'
(R):5'- GATGCTATGTTGTCTTCACCAACAG -3'
Posted On 2022-07-18