Incidental Mutation 'R9514:Cfap65'
ID 718344
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74906309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably null
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,992 V338A probably damaging Het
1810065E05Rik T C 11: 58,421,707 S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acsl6 A G 11: 54,335,054 N307D probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
Cacna2d4 T C 6: 119,236,650 L10S probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Cebpz A T 17: 78,932,255 M579K probably benign Het
Cenpk T G 13: 104,234,174 C103G probably benign Het
Cep97 T A 16: 55,905,730 Q670L probably benign Het
Cir1 A G 2: 73,312,437 S18P probably damaging Het
Coprs T C 8: 13,885,081 Y158C probably damaging Het
Creld1 T C 6: 113,492,804 F389S probably damaging Het
Dimt1 T C 13: 106,957,128 I276T possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dsp T A 13: 38,187,805 C911S probably benign Het
Egr3 A G 14: 70,077,529 I29V probably benign Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fam83a G A 15: 57,986,369 G103D possibly damaging Het
Fat2 T A 11: 55,284,982 Q1635L probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Fryl T C 5: 73,104,772 K551E probably damaging Het
Galr2 A G 11: 116,283,626 T361A probably benign Het
Gart A T 16: 91,630,708 S467R probably benign Het
Ggps1 T C 13: 14,055,157 K45R probably benign Het
Ghsr G C 3: 27,372,481 V229L possibly damaging Het
Hectd2 A T 19: 36,605,289 H473L possibly damaging Het
Hic2 T C 16: 17,258,429 V374A possibly damaging Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt34 A T 11: 100,038,400 I328N probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Mau2 T C 8: 70,027,503 Y318C probably damaging Het
Mier2 T C 10: 79,541,662 S486G probably benign Het
Mllt10 A G 2: 18,159,511 D284G probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Ncoa6 A G 2: 155,406,213 S1724P probably benign Het
Nipal4 T A 11: 46,162,095 probably null Het
Nlrc4 G C 17: 74,446,741 L216V probably benign Het
Ogfr A G 2: 180,593,624 M164V possibly damaging Het
Olfr1271 G A 2: 90,266,365 Q22* probably null Het
Olfr99 G T 17: 37,280,495 probably benign Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pkd1l3 T C 8: 109,669,217 V2083A probably damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Prex1 C T 2: 166,577,976 R1260Q possibly damaging Het
Prpf38b A G 3: 108,911,303 V47A probably benign Het
Ptch1 T C 13: 63,527,257 T851A probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Ptprm A G 17: 66,809,471 Y938H probably damaging Het
R3hcc1l G A 19: 42,518,764 probably benign Het
Rapgef6 T C 11: 54,552,858 V89A probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,467,593 probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,467,598 probably benign Het
Slain1 T A 14: 103,695,312 V444E probably damaging Het
Slc10a5 T A 3: 10,335,472 I43F possibly damaging Het
Smarca2 T C 19: 26,682,052 F914S possibly damaging Het
Smarca5 A C 8: 80,702,211 L1003V probably damaging Het
Spata18 A T 5: 73,672,497 I332F Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tktl2 C G 8: 66,513,188 A466G probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tom1l2 T C 11: 60,262,660 T164A probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Trim11 G T 11: 58,987,651 A251S unknown Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Trpm3 A G 19: 22,982,676 N1225S probably benign Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Usp21 T C 1: 171,284,930 Y300C probably damaging Het
Usp32 T C 11: 85,022,734 T924A probably damaging Het
Vmn1r198 A T 13: 22,354,845 H167L possibly damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Zc3h8 T C 2: 128,931,303 Y213C probably damaging Het
Zcchc17 A T 4: 130,338,544 D55E probably benign Het
Zfp408 A T 2: 91,648,023 W26R probably damaging Het
Zfp937 G T 2: 150,238,970 A307S possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCCTGTGGATTTGGG -3'
(R):5'- TCTTCATGACCCCAAAGCTG -3'

Sequencing Primer
(F):5'- ATGCAGCAAGGTGGTCC -3'
(R):5'- GATGCTATGTTGTCTTCACCAACAG -3'
Posted On 2022-07-18