Incidental Mutation 'R9514:Vmn2r23'
ID 718373
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123712713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: T183A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T183A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,992 V338A probably damaging Het
1810065E05Rik T C 11: 58,421,707 S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acsl6 A G 11: 54,335,054 N307D probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
Cacna2d4 T C 6: 119,236,650 L10S probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Cebpz A T 17: 78,932,255 M579K probably benign Het
Cenpk T G 13: 104,234,174 C103G probably benign Het
Cep97 T A 16: 55,905,730 Q670L probably benign Het
Cfap65 C T 1: 74,906,309 probably null Het
Cir1 A G 2: 73,312,437 S18P probably damaging Het
Coprs T C 8: 13,885,081 Y158C probably damaging Het
Creld1 T C 6: 113,492,804 F389S probably damaging Het
Dimt1 T C 13: 106,957,128 I276T possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dsp T A 13: 38,187,805 C911S probably benign Het
Egr3 A G 14: 70,077,529 I29V probably benign Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fam83a G A 15: 57,986,369 G103D possibly damaging Het
Fat2 T A 11: 55,284,982 Q1635L probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Fryl T C 5: 73,104,772 K551E probably damaging Het
Galr2 A G 11: 116,283,626 T361A probably benign Het
Gart A T 16: 91,630,708 S467R probably benign Het
Ggps1 T C 13: 14,055,157 K45R probably benign Het
Ghsr G C 3: 27,372,481 V229L possibly damaging Het
Hectd2 A T 19: 36,605,289 H473L possibly damaging Het
Hic2 T C 16: 17,258,429 V374A possibly damaging Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt34 A T 11: 100,038,400 I328N probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Mau2 T C 8: 70,027,503 Y318C probably damaging Het
Mier2 T C 10: 79,541,662 S486G probably benign Het
Mllt10 A G 2: 18,159,511 D284G probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Ncoa6 A G 2: 155,406,213 S1724P probably benign Het
Nipal4 T A 11: 46,162,095 probably null Het
Nlrc4 G C 17: 74,446,741 L216V probably benign Het
Ogfr A G 2: 180,593,624 M164V possibly damaging Het
Olfr1271 G A 2: 90,266,365 Q22* probably null Het
Olfr99 G T 17: 37,280,495 probably benign Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pkd1l3 T C 8: 109,669,217 V2083A probably damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Prex1 C T 2: 166,577,976 R1260Q possibly damaging Het
Prpf38b A G 3: 108,911,303 V47A probably benign Het
Ptch1 T C 13: 63,527,257 T851A probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Ptprm A G 17: 66,809,471 Y938H probably damaging Het
R3hcc1l G A 19: 42,518,764 probably benign Het
Rapgef6 T C 11: 54,552,858 V89A probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,467,593 probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,467,598 probably benign Het
Slain1 T A 14: 103,695,312 V444E probably damaging Het
Slc10a5 T A 3: 10,335,472 I43F possibly damaging Het
Smarca2 T C 19: 26,682,052 F914S possibly damaging Het
Smarca5 A C 8: 80,702,211 L1003V probably damaging Het
Spata18 A T 5: 73,672,497 I332F Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tktl2 C G 8: 66,513,188 A466G probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tom1l2 T C 11: 60,262,660 T164A probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Trim11 G T 11: 58,987,651 A251S unknown Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Trpm3 A G 19: 22,982,676 N1225S probably benign Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Usp21 T C 1: 171,284,930 Y300C probably damaging Het
Usp32 T C 11: 85,022,734 T924A probably damaging Het
Vmn1r198 A T 13: 22,354,845 H167L possibly damaging Het
Zc3h8 T C 2: 128,931,303 Y213C probably damaging Het
Zcchc17 A T 4: 130,338,544 D55E probably benign Het
Zfp408 A T 2: 91,648,023 W26R probably damaging Het
Zfp937 G T 2: 150,238,970 A307S possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123741823 missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGAAACATTTCCTGTGAGCAG -3'
(R):5'- ACAAAGTCCATGGTTCGTCATC -3'

Sequencing Primer
(F):5'- TTCCTGTGAGCAGTTAGAAGAC -3'
(R):5'- CTCCTCTGTGATGTCCCTAAGGAAG -3'
Posted On 2022-07-18