Incidental Mutation 'R9514:Usp32'
ID 718396
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 2900074J03Rik, 6430526O11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84875268-85030987 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84913560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 924 (T924A)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: T222A

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: T924A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: T924A

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,312,533 (GRCm39) S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Acsl6 A G 11: 54,225,880 (GRCm39) N307D probably benign Het
Atxn1 A G 13: 45,721,433 (GRCm39) V154A probably benign Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Cacna2d4 T C 6: 119,213,611 (GRCm39) L10S probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Cebpz A T 17: 79,239,684 (GRCm39) M579K probably benign Het
Cenpk T G 13: 104,370,682 (GRCm39) C103G probably benign Het
Cep97 T A 16: 55,726,093 (GRCm39) Q670L probably benign Het
Cfap65 C T 1: 74,945,468 (GRCm39) probably null Het
Cir1 A G 2: 73,142,781 (GRCm39) S18P probably damaging Het
Coprs T C 8: 13,935,081 (GRCm39) Y158C probably damaging Het
Creld1 T C 6: 113,469,765 (GRCm39) F389S probably damaging Het
Dimt1 T C 13: 107,093,636 (GRCm39) I276T possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Dsp T A 13: 38,371,781 (GRCm39) C911S probably benign Het
Egr3 A G 14: 70,314,978 (GRCm39) I29V probably benign Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fam83a G A 15: 57,849,765 (GRCm39) G103D possibly damaging Het
Fat2 T A 11: 55,175,808 (GRCm39) Q1635L probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Fryl T C 5: 73,262,115 (GRCm39) K551E probably damaging Het
Galr2 A G 11: 116,174,452 (GRCm39) T361A probably benign Het
Gart A T 16: 91,427,596 (GRCm39) S467R probably benign Het
Ggps1 T C 13: 14,229,742 (GRCm39) K45R probably benign Het
Ghsr G C 3: 27,426,630 (GRCm39) V229L possibly damaging Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hectd2 A T 19: 36,582,689 (GRCm39) H473L possibly damaging Het
Hic2 T C 16: 17,076,293 (GRCm39) V374A possibly damaging Het
Hivep2 T A 10: 14,005,523 (GRCm39) I707N probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt34 A T 11: 99,929,226 (GRCm39) I328N probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lama2 T C 10: 27,100,015 (GRCm39) E830G probably benign Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Mau2 T C 8: 70,480,153 (GRCm39) Y318C probably damaging Het
Mier2 T C 10: 79,377,496 (GRCm39) S486G probably benign Het
Mllt10 A G 2: 18,164,322 (GRCm39) D284G probably damaging Het
Nbea A T 3: 55,937,366 (GRCm39) S748R probably damaging Het
Ncoa6 A G 2: 155,248,133 (GRCm39) S1724P probably benign Het
Nipal4 T A 11: 46,052,922 (GRCm39) probably null Het
Nlrc4 G C 17: 74,753,736 (GRCm39) L216V probably benign Het
Ogfr A G 2: 180,235,417 (GRCm39) M164V possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4b12 G A 2: 90,096,709 (GRCm39) Q22* probably null Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pkd1l3 T C 8: 110,395,849 (GRCm39) V2083A probably damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Prex1 C T 2: 166,419,896 (GRCm39) R1260Q possibly damaging Het
Prpf38b A G 3: 108,818,619 (GRCm39) V47A probably benign Het
Ptch1 T C 13: 63,675,071 (GRCm39) T851A probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Ptprm A G 17: 67,116,466 (GRCm39) Y938H probably damaging Het
R3hcc1l G A 19: 42,507,203 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,443,684 (GRCm39) V89A probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,066,770 (GRCm39) probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,066,750 (GRCm39) probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,066,765 (GRCm39) probably benign Het
Slain1 T A 14: 103,932,748 (GRCm39) V444E probably damaging Het
Slc10a5 T A 3: 10,400,532 (GRCm39) I43F possibly damaging Het
Smarca2 T C 19: 26,659,452 (GRCm39) F914S possibly damaging Het
Smarca5 A C 8: 81,428,840 (GRCm39) L1003V probably damaging Het
Spata18 A T 5: 73,829,840 (GRCm39) I332F Het
Spata31d1e A G 13: 59,890,806 (GRCm39) V338A probably damaging Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tktl2 C G 8: 66,965,840 (GRCm39) A466G probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tom1l2 T C 11: 60,153,486 (GRCm39) T164A probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Tpp2 T A 1: 44,017,648 (GRCm39) S751T probably benign Het
Trim11 G T 11: 58,878,477 (GRCm39) A251S unknown Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Trpm3 A G 19: 22,960,040 (GRCm39) N1225S probably benign Het
Usp21 T C 1: 171,112,503 (GRCm39) Y300C probably damaging Het
Vmn1r198 A T 13: 22,539,015 (GRCm39) H167L possibly damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Zc3h8 T C 2: 128,773,223 (GRCm39) Y213C probably damaging Het
Zcchc17 A T 4: 130,232,337 (GRCm39) D55E probably benign Het
Zfp408 A T 2: 91,478,368 (GRCm39) W26R probably damaging Het
Zfp937 G T 2: 150,080,890 (GRCm39) A307S possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84,885,252 (GRCm39) missense probably damaging 1.00
IGL00701:Usp32 APN 11 84,949,951 (GRCm39) splice site probably null
IGL00848:Usp32 APN 11 84,942,007 (GRCm39) splice site probably benign
IGL00934:Usp32 APN 11 84,897,902 (GRCm39) missense probably damaging 1.00
IGL01019:Usp32 APN 11 84,930,091 (GRCm39) missense probably damaging 0.97
IGL01302:Usp32 APN 11 84,879,308 (GRCm39) missense probably benign 0.05
IGL01444:Usp32 APN 11 84,949,990 (GRCm39) missense probably damaging 0.97
IGL01575:Usp32 APN 11 84,913,628 (GRCm39) missense probably damaging 1.00
IGL01981:Usp32 APN 11 84,927,350 (GRCm39) missense probably benign 0.02
IGL02118:Usp32 APN 11 84,923,003 (GRCm39) nonsense probably null
IGL02159:Usp32 APN 11 84,896,628 (GRCm39) splice site probably null
IGL02227:Usp32 APN 11 84,877,307 (GRCm39) missense probably damaging 1.00
IGL02363:Usp32 APN 11 84,935,613 (GRCm39) missense probably benign 0.01
IGL02524:Usp32 APN 11 84,900,837 (GRCm39) nonsense probably null
IGL02613:Usp32 APN 11 84,930,896 (GRCm39) missense probably damaging 0.99
IGL02720:Usp32 APN 11 84,897,817 (GRCm39) critical splice donor site probably null
IGL02738:Usp32 APN 11 84,974,632 (GRCm39) missense probably damaging 1.00
IGL02929:Usp32 APN 11 84,879,198 (GRCm39) missense probably benign 0.01
IGL03303:Usp32 APN 11 84,913,658 (GRCm39) missense probably damaging 1.00
BB010:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
BB020:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 84,900,900 (GRCm39) missense probably damaging 1.00
R0026:Usp32 UTSW 11 84,922,900 (GRCm39) missense possibly damaging 0.48
R0295:Usp32 UTSW 11 84,944,518 (GRCm39) missense probably damaging 0.98
R1320:Usp32 UTSW 11 84,908,619 (GRCm39) missense probably damaging 0.98
R1712:Usp32 UTSW 11 84,933,406 (GRCm39) missense probably benign 0.12
R1922:Usp32 UTSW 11 84,897,830 (GRCm39) nonsense probably null
R1973:Usp32 UTSW 11 84,994,757 (GRCm39) missense probably benign 0.09
R2010:Usp32 UTSW 11 84,930,830 (GRCm39) missense probably damaging 0.98
R2082:Usp32 UTSW 11 84,921,338 (GRCm39) missense probably damaging 0.99
R2355:Usp32 UTSW 11 84,896,735 (GRCm39) missense probably benign 0.34
R3147:Usp32 UTSW 11 84,919,913 (GRCm39) missense probably damaging 1.00
R3160:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3162:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3716:Usp32 UTSW 11 84,933,389 (GRCm39) missense probably damaging 1.00
R3816:Usp32 UTSW 11 84,885,210 (GRCm39) critical splice donor site probably null
R3870:Usp32 UTSW 11 84,897,881 (GRCm39) nonsense probably null
R3871:Usp32 UTSW 11 84,971,982 (GRCm39) missense probably null 0.81
R4041:Usp32 UTSW 11 84,908,565 (GRCm39) missense probably benign 0.40
R4079:Usp32 UTSW 11 84,930,055 (GRCm39) missense probably damaging 0.98
R4332:Usp32 UTSW 11 84,994,804 (GRCm39) missense possibly damaging 0.79
R4396:Usp32 UTSW 11 84,944,801 (GRCm39) missense probably benign
R4580:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4620:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4744:Usp32 UTSW 11 84,885,219 (GRCm39) missense probably damaging 1.00
R4909:Usp32 UTSW 11 84,946,598 (GRCm39) nonsense probably null
R5056:Usp32 UTSW 11 84,917,621 (GRCm39) missense probably benign 0.07
R5111:Usp32 UTSW 11 84,968,157 (GRCm39) missense possibly damaging 0.95
R5213:Usp32 UTSW 11 84,913,085 (GRCm39) missense probably damaging 1.00
R5308:Usp32 UTSW 11 84,908,544 (GRCm39) missense probably benign 0.12
R5381:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably benign
R5538:Usp32 UTSW 11 84,908,612 (GRCm39) missense possibly damaging 0.65
R5659:Usp32 UTSW 11 84,968,240 (GRCm39) missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84,883,277 (GRCm39) critical splice donor site probably null
R6011:Usp32 UTSW 11 84,922,923 (GRCm39) missense possibly damaging 0.70
R6029:Usp32 UTSW 11 84,916,408 (GRCm39) missense probably damaging 0.99
R6074:Usp32 UTSW 11 84,885,399 (GRCm39) missense probably benign 0.00
R6331:Usp32 UTSW 11 84,877,402 (GRCm39) missense possibly damaging 0.92
R6353:Usp32 UTSW 11 84,913,107 (GRCm39) missense probably benign
R6714:Usp32 UTSW 11 84,917,696 (GRCm39) missense probably damaging 0.99
R6778:Usp32 UTSW 11 84,916,512 (GRCm39) missense probably benign 0.00
R6988:Usp32 UTSW 11 84,900,969 (GRCm39) missense probably benign 0.35
R6992:Usp32 UTSW 11 84,922,914 (GRCm39) missense probably damaging 0.99
R7182:Usp32 UTSW 11 84,930,996 (GRCm39) missense probably benign 0.34
R7186:Usp32 UTSW 11 84,942,060 (GRCm39) missense probably benign 0.45
R7198:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7201:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7469:Usp32 UTSW 11 84,879,379 (GRCm39) missense possibly damaging 0.94
R7502:Usp32 UTSW 11 84,913,724 (GRCm39) missense possibly damaging 0.48
R7513:Usp32 UTSW 11 84,917,938 (GRCm39) nonsense probably null
R7629:Usp32 UTSW 11 84,910,681 (GRCm39) frame shift probably null
R7703:Usp32 UTSW 11 84,968,153 (GRCm39) missense probably damaging 0.99
R7741:Usp32 UTSW 11 84,878,107 (GRCm39) missense probably damaging 0.99
R7765:Usp32 UTSW 11 84,885,234 (GRCm39) missense probably damaging 1.00
R7933:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
R7973:Usp32 UTSW 11 84,913,634 (GRCm39) missense probably damaging 0.99
R7989:Usp32 UTSW 11 84,925,126 (GRCm39) missense
R7998:Usp32 UTSW 11 84,885,252 (GRCm39) missense probably damaging 1.00
R8292:Usp32 UTSW 11 84,968,227 (GRCm39) missense probably damaging 0.99
R8305:Usp32 UTSW 11 84,923,011 (GRCm39) missense possibly damaging 0.83
R8548:Usp32 UTSW 11 84,908,653 (GRCm39) missense possibly damaging 0.52
R8924:Usp32 UTSW 11 84,916,370 (GRCm39) missense probably damaging 0.98
R9002:Usp32 UTSW 11 84,944,777 (GRCm39) missense probably damaging 0.96
R9145:Usp32 UTSW 11 84,913,118 (GRCm39) missense probably damaging 1.00
R9209:Usp32 UTSW 11 84,930,838 (GRCm39) missense probably damaging 0.98
R9211:Usp32 UTSW 11 84,913,559 (GRCm39) missense probably damaging 1.00
R9296:Usp32 UTSW 11 84,908,478 (GRCm39) missense probably damaging 1.00
R9310:Usp32 UTSW 11 84,942,028 (GRCm39) missense probably benign 0.29
R9417:Usp32 UTSW 11 84,885,369 (GRCm39) missense probably damaging 1.00
R9652:Usp32 UTSW 11 84,921,317 (GRCm39) missense probably damaging 0.97
R9723:Usp32 UTSW 11 84,935,536 (GRCm39) nonsense probably null
R9757:Usp32 UTSW 11 84,968,155 (GRCm39) nonsense probably null
X0028:Usp32 UTSW 11 84,883,432 (GRCm39) missense probably benign 0.05
Z1177:Usp32 UTSW 11 84,879,438 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTTTCTTCCACGTCTGG -3'
(R):5'- AATTCTTTTCCTTGATAGGCCTGG -3'

Sequencing Primer
(F):5'- TCCACGTCTGGAATTTAAGAAACGC -3'
(R):5'- TTCCTTGATAGGCCTGGGACAAC -3'
Posted On 2022-07-18