Incidental Mutation 'R9514:Usp32'
ID 718396
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85022734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 924 (T924A)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: T222A

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: T924A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: T924A

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,992 V338A probably damaging Het
1810065E05Rik T C 11: 58,421,707 S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acsl6 A G 11: 54,335,054 N307D probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
Cacna2d4 T C 6: 119,236,650 L10S probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Cebpz A T 17: 78,932,255 M579K probably benign Het
Cenpk T G 13: 104,234,174 C103G probably benign Het
Cep97 T A 16: 55,905,730 Q670L probably benign Het
Cfap65 C T 1: 74,906,309 probably null Het
Cir1 A G 2: 73,312,437 S18P probably damaging Het
Coprs T C 8: 13,885,081 Y158C probably damaging Het
Creld1 T C 6: 113,492,804 F389S probably damaging Het
Dimt1 T C 13: 106,957,128 I276T possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dsp T A 13: 38,187,805 C911S probably benign Het
Egr3 A G 14: 70,077,529 I29V probably benign Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fam83a G A 15: 57,986,369 G103D possibly damaging Het
Fat2 T A 11: 55,284,982 Q1635L probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Fryl T C 5: 73,104,772 K551E probably damaging Het
Galr2 A G 11: 116,283,626 T361A probably benign Het
Gart A T 16: 91,630,708 S467R probably benign Het
Ggps1 T C 13: 14,055,157 K45R probably benign Het
Ghsr G C 3: 27,372,481 V229L possibly damaging Het
Hectd2 A T 19: 36,605,289 H473L possibly damaging Het
Hic2 T C 16: 17,258,429 V374A possibly damaging Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt34 A T 11: 100,038,400 I328N probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Mau2 T C 8: 70,027,503 Y318C probably damaging Het
Mier2 T C 10: 79,541,662 S486G probably benign Het
Mllt10 A G 2: 18,159,511 D284G probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Ncoa6 A G 2: 155,406,213 S1724P probably benign Het
Nipal4 T A 11: 46,162,095 probably null Het
Nlrc4 G C 17: 74,446,741 L216V probably benign Het
Ogfr A G 2: 180,593,624 M164V possibly damaging Het
Olfr1271 G A 2: 90,266,365 Q22* probably null Het
Olfr99 G T 17: 37,280,495 probably benign Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pkd1l3 T C 8: 109,669,217 V2083A probably damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Prex1 C T 2: 166,577,976 R1260Q possibly damaging Het
Prpf38b A G 3: 108,911,303 V47A probably benign Het
Ptch1 T C 13: 63,527,257 T851A probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Ptprm A G 17: 66,809,471 Y938H probably damaging Het
R3hcc1l G A 19: 42,518,764 probably benign Het
Rapgef6 T C 11: 54,552,858 V89A probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,467,593 probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,467,598 probably benign Het
Slain1 T A 14: 103,695,312 V444E probably damaging Het
Slc10a5 T A 3: 10,335,472 I43F possibly damaging Het
Smarca2 T C 19: 26,682,052 F914S possibly damaging Het
Smarca5 A C 8: 80,702,211 L1003V probably damaging Het
Spata18 A T 5: 73,672,497 I332F Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tktl2 C G 8: 66,513,188 A466G probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tom1l2 T C 11: 60,262,660 T164A probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Trim11 G T 11: 58,987,651 A251S unknown Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Trpm3 A G 19: 22,982,676 N1225S probably benign Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Usp21 T C 1: 171,284,930 Y300C probably damaging Het
Vmn1r198 A T 13: 22,354,845 H167L possibly damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Zc3h8 T C 2: 128,931,303 Y213C probably damaging Het
Zcchc17 A T 4: 130,338,544 D55E probably benign Het
Zfp408 A T 2: 91,648,023 W26R probably damaging Het
Zfp937 G T 2: 150,238,970 A307S possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTTTCTTCCACGTCTGG -3'
(R):5'- AATTCTTTTCCTTGATAGGCCTGG -3'

Sequencing Primer
(F):5'- TCCACGTCTGGAATTTAAGAAACGC -3'
(R):5'- TTCCTTGATAGGCCTGGGACAAC -3'
Posted On 2022-07-18