Incidental Mutation 'R9514:Krt34'
ID 718397
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms 4733401E01Rik, Krt1-4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 99928173-99932380 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99929226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 328 (I328N)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect probably damaging
Transcript: ENSMUST00000056362
AA Change: I328N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: I328N

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,312,533 (GRCm39) S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Acsl6 A G 11: 54,225,880 (GRCm39) N307D probably benign Het
Atxn1 A G 13: 45,721,433 (GRCm39) V154A probably benign Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Cacna2d4 T C 6: 119,213,611 (GRCm39) L10S probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Cebpz A T 17: 79,239,684 (GRCm39) M579K probably benign Het
Cenpk T G 13: 104,370,682 (GRCm39) C103G probably benign Het
Cep97 T A 16: 55,726,093 (GRCm39) Q670L probably benign Het
Cfap65 C T 1: 74,945,468 (GRCm39) probably null Het
Cir1 A G 2: 73,142,781 (GRCm39) S18P probably damaging Het
Coprs T C 8: 13,935,081 (GRCm39) Y158C probably damaging Het
Creld1 T C 6: 113,469,765 (GRCm39) F389S probably damaging Het
Dimt1 T C 13: 107,093,636 (GRCm39) I276T possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Dsp T A 13: 38,371,781 (GRCm39) C911S probably benign Het
Egr3 A G 14: 70,314,978 (GRCm39) I29V probably benign Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fam83a G A 15: 57,849,765 (GRCm39) G103D possibly damaging Het
Fat2 T A 11: 55,175,808 (GRCm39) Q1635L probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Fryl T C 5: 73,262,115 (GRCm39) K551E probably damaging Het
Galr2 A G 11: 116,174,452 (GRCm39) T361A probably benign Het
Gart A T 16: 91,427,596 (GRCm39) S467R probably benign Het
Ggps1 T C 13: 14,229,742 (GRCm39) K45R probably benign Het
Ghsr G C 3: 27,426,630 (GRCm39) V229L possibly damaging Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hectd2 A T 19: 36,582,689 (GRCm39) H473L possibly damaging Het
Hic2 T C 16: 17,076,293 (GRCm39) V374A possibly damaging Het
Hivep2 T A 10: 14,005,523 (GRCm39) I707N probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lama2 T C 10: 27,100,015 (GRCm39) E830G probably benign Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Mau2 T C 8: 70,480,153 (GRCm39) Y318C probably damaging Het
Mier2 T C 10: 79,377,496 (GRCm39) S486G probably benign Het
Mllt10 A G 2: 18,164,322 (GRCm39) D284G probably damaging Het
Nbea A T 3: 55,937,366 (GRCm39) S748R probably damaging Het
Ncoa6 A G 2: 155,248,133 (GRCm39) S1724P probably benign Het
Nipal4 T A 11: 46,052,922 (GRCm39) probably null Het
Nlrc4 G C 17: 74,753,736 (GRCm39) L216V probably benign Het
Ogfr A G 2: 180,235,417 (GRCm39) M164V possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4b12 G A 2: 90,096,709 (GRCm39) Q22* probably null Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pkd1l3 T C 8: 110,395,849 (GRCm39) V2083A probably damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Prex1 C T 2: 166,419,896 (GRCm39) R1260Q possibly damaging Het
Prpf38b A G 3: 108,818,619 (GRCm39) V47A probably benign Het
Ptch1 T C 13: 63,675,071 (GRCm39) T851A probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Ptprm A G 17: 67,116,466 (GRCm39) Y938H probably damaging Het
R3hcc1l G A 19: 42,507,203 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,443,684 (GRCm39) V89A probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,066,770 (GRCm39) probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,066,750 (GRCm39) probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,066,765 (GRCm39) probably benign Het
Slain1 T A 14: 103,932,748 (GRCm39) V444E probably damaging Het
Slc10a5 T A 3: 10,400,532 (GRCm39) I43F possibly damaging Het
Smarca2 T C 19: 26,659,452 (GRCm39) F914S possibly damaging Het
Smarca5 A C 8: 81,428,840 (GRCm39) L1003V probably damaging Het
Spata18 A T 5: 73,829,840 (GRCm39) I332F Het
Spata31d1e A G 13: 59,890,806 (GRCm39) V338A probably damaging Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tktl2 C G 8: 66,965,840 (GRCm39) A466G probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tom1l2 T C 11: 60,153,486 (GRCm39) T164A probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Tpp2 T A 1: 44,017,648 (GRCm39) S751T probably benign Het
Trim11 G T 11: 58,878,477 (GRCm39) A251S unknown Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Trpm3 A G 19: 22,960,040 (GRCm39) N1225S probably benign Het
Usp21 T C 1: 171,112,503 (GRCm39) Y300C probably damaging Het
Usp32 T C 11: 84,913,560 (GRCm39) T924A probably damaging Het
Vmn1r198 A T 13: 22,539,015 (GRCm39) H167L possibly damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Zc3h8 T C 2: 128,773,223 (GRCm39) Y213C probably damaging Het
Zcchc17 A T 4: 130,232,337 (GRCm39) D55E probably benign Het
Zfp408 A T 2: 91,478,368 (GRCm39) W26R probably damaging Het
Zfp937 G T 2: 150,080,890 (GRCm39) A307S possibly damaging Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 99,929,520 (GRCm39) splice site probably benign
IGL01323:Krt34 APN 11 99,929,606 (GRCm39) missense possibly damaging 0.95
IGL01403:Krt34 APN 11 99,929,116 (GRCm39) missense possibly damaging 0.88
IGL01453:Krt34 APN 11 99,930,916 (GRCm39) missense probably damaging 1.00
IGL02031:Krt34 APN 11 99,929,849 (GRCm39) missense possibly damaging 0.95
IGL02831:Krt34 APN 11 99,930,973 (GRCm39) splice site probably benign
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0220:Krt34 UTSW 11 99,929,519 (GRCm39) splice site probably benign
R0242:Krt34 UTSW 11 99,932,157 (GRCm39) missense probably damaging 1.00
R1573:Krt34 UTSW 11 99,931,854 (GRCm39) missense probably benign 0.01
R1714:Krt34 UTSW 11 99,930,953 (GRCm39) missense possibly damaging 0.95
R1879:Krt34 UTSW 11 99,929,118 (GRCm39) missense possibly damaging 0.76
R3084:Krt34 UTSW 11 99,931,847 (GRCm39) missense probably damaging 1.00
R3692:Krt34 UTSW 11 99,929,857 (GRCm39) missense probably damaging 1.00
R3819:Krt34 UTSW 11 99,930,844 (GRCm39) missense probably damaging 1.00
R3872:Krt34 UTSW 11 99,932,243 (GRCm39) missense probably benign
R3876:Krt34 UTSW 11 99,931,791 (GRCm39) missense probably benign 0.02
R6164:Krt34 UTSW 11 99,929,272 (GRCm39) nonsense probably null
R6338:Krt34 UTSW 11 99,929,316 (GRCm39) missense probably benign 0.00
R6457:Krt34 UTSW 11 99,930,916 (GRCm39) missense probably damaging 1.00
R7728:Krt34 UTSW 11 99,930,811 (GRCm39) critical splice donor site probably null
R7748:Krt34 UTSW 11 99,929,764 (GRCm39) missense probably damaging 1.00
R7903:Krt34 UTSW 11 99,932,321 (GRCm39) start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 99,930,901 (GRCm39) missense probably damaging 1.00
R8480:Krt34 UTSW 11 99,930,971 (GRCm39) critical splice acceptor site probably null
R9262:Krt34 UTSW 11 99,930,851 (GRCm39) missense probably benign 0.15
Z1176:Krt34 UTSW 11 99,932,260 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACAAATTGCTGTAGGCTTTC -3'
(R):5'- GAAGTCATGCAGAAACCTTCAG -3'

Sequencing Primer
(F):5'- AATATGGCCATCGTAAGTGTGTCTCC -3'
(R):5'- CTTCAGAGGGAACAGCTCTGTG -3'
Posted On 2022-07-18