Incidental Mutation 'R9514:Ptk7'
ID 718418
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene Name PTK7 protein tyrosine kinase 7
Synonyms 8430404F20Rik, mPTK7/CCK4, chz
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 46564451-46629504 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46576818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 563 (I563F)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
AlphaFold Q8BKG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000044442
AA Change: I563F

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: I563F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,992 V338A probably damaging Het
1810065E05Rik T C 11: 58,421,707 S4P probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acsl6 A G 11: 54,335,054 N307D probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
Cacna2d4 T C 6: 119,236,650 L10S probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Cebpz A T 17: 78,932,255 M579K probably benign Het
Cenpk T G 13: 104,234,174 C103G probably benign Het
Cep97 T A 16: 55,905,730 Q670L probably benign Het
Cfap65 C T 1: 74,906,309 probably null Het
Cir1 A G 2: 73,312,437 S18P probably damaging Het
Coprs T C 8: 13,885,081 Y158C probably damaging Het
Creld1 T C 6: 113,492,804 F389S probably damaging Het
Dimt1 T C 13: 106,957,128 I276T possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dsp T A 13: 38,187,805 C911S probably benign Het
Egr3 A G 14: 70,077,529 I29V probably benign Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fam83a G A 15: 57,986,369 G103D possibly damaging Het
Fat2 T A 11: 55,284,982 Q1635L probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Fryl T C 5: 73,104,772 K551E probably damaging Het
Galr2 A G 11: 116,283,626 T361A probably benign Het
Gart A T 16: 91,630,708 S467R probably benign Het
Ggps1 T C 13: 14,055,157 K45R probably benign Het
Ghsr G C 3: 27,372,481 V229L possibly damaging Het
Hectd2 A T 19: 36,605,289 H473L possibly damaging Het
Hic2 T C 16: 17,258,429 V374A possibly damaging Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt34 A T 11: 100,038,400 I328N probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Mau2 T C 8: 70,027,503 Y318C probably damaging Het
Mier2 T C 10: 79,541,662 S486G probably benign Het
Mllt10 A G 2: 18,159,511 D284G probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Ncoa6 A G 2: 155,406,213 S1724P probably benign Het
Nipal4 T A 11: 46,162,095 probably null Het
Nlrc4 G C 17: 74,446,741 L216V probably benign Het
Ogfr A G 2: 180,593,624 M164V possibly damaging Het
Olfr1271 G A 2: 90,266,365 Q22* probably null Het
Olfr99 G T 17: 37,280,495 probably benign Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pkd1l3 T C 8: 109,669,217 V2083A probably damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Prex1 C T 2: 166,577,976 R1260Q possibly damaging Het
Prpf38b A G 3: 108,911,303 V47A probably benign Het
Ptch1 T C 13: 63,527,257 T851A probably benign Het
Ptprm A G 17: 66,809,471 Y938H probably damaging Het
R3hcc1l G A 19: 42,518,764 probably benign Het
Rapgef6 T C 11: 54,552,858 V89A probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 ACCAGCTC ACCAGCTCAGCCACGGGGGCCAGCTC 7: 126,467,593 probably benign Het
Sh2b1 CTC CTCCGCCACGGGGACCAGTTC 7: 126,467,598 probably benign Het
Slain1 T A 14: 103,695,312 V444E probably damaging Het
Slc10a5 T A 3: 10,335,472 I43F possibly damaging Het
Smarca2 T C 19: 26,682,052 F914S possibly damaging Het
Smarca5 A C 8: 80,702,211 L1003V probably damaging Het
Spata18 A T 5: 73,672,497 I332F Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tktl2 C G 8: 66,513,188 A466G probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tom1l2 T C 11: 60,262,660 T164A probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Trim11 G T 11: 58,987,651 A251S unknown Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Trpm3 A G 19: 22,982,676 N1225S probably benign Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Usp21 T C 1: 171,284,930 Y300C probably damaging Het
Usp32 T C 11: 85,022,734 T924A probably damaging Het
Vmn1r198 A T 13: 22,354,845 H167L possibly damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Zc3h8 T C 2: 128,931,303 Y213C probably damaging Het
Zcchc17 A T 4: 130,338,544 D55E probably benign Het
Zfp408 A T 2: 91,648,023 W26R probably damaging Het
Zfp937 G T 2: 150,238,970 A307S possibly damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
R7949:Ptk7 UTSW 17 46586461 missense possibly damaging 0.64
R8773:Ptk7 UTSW 17 46566267 missense possibly damaging 0.88
R9059:Ptk7 UTSW 17 46566191 missense probably damaging 1.00
R9327:Ptk7 UTSW 17 46568051 missense probably benign 0.17
R9495:Ptk7 UTSW 17 46576818 missense possibly damaging 0.82
R9638:Ptk7 UTSW 17 46579593 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACACAGTTGTACGCTCAGGTTC -3'
(R):5'- TTGGGGTAGAGACGAGTAACCC -3'

Sequencing Primer
(F):5'- GTACGCTCAGGTTCCACTTTGAAG -3'
(R):5'- CGAAGGCCTTCTCAGCCATTC -3'
Posted On 2022-07-18