Incidental Mutation 'R9515:Hdc'
ID 718442
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R9515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 126593667-126619299 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 126616229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 58 (P58T)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably damaging
Transcript: ENSMUST00000028838
AA Change: P58T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: P58T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Aamdc A G 7: 97,575,601 V18A probably benign Het
Adam12 T A 7: 133,907,644 I796F probably benign Het
Adcy7 T A 8: 88,311,018 V238E possibly damaging Het
Adgrv1 G A 13: 81,543,378 H1697Y probably damaging Het
Adrb1 A G 19: 56,723,393 D341G probably benign Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Akap9 C T 5: 4,055,709 L2927F probably damaging Het
Alox8 T A 11: 69,185,124 D667V probably damaging Het
Arhgap30 A G 1: 171,408,434 E792G probably benign Het
Arhgef16 A G 4: 154,280,975 V561A possibly damaging Het
Bcap29 A T 12: 31,626,757 Y105N probably damaging Het
Best2 T A 8: 85,013,518 T6S Het
Bfsp2 C A 9: 103,480,052 V59L possibly damaging Het
Brd3 T A 2: 27,459,803 D246V Het
Btnl1 T A 17: 34,381,144 V207E probably benign Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccdc122 T A 14: 77,091,968 Y154N Het
Cfap43 A G 19: 47,785,375 Y656H probably damaging Het
Clca3a2 A T 3: 144,803,047 Y670* probably null Het
Coprs T C 8: 13,885,081 Y158C probably damaging Het
Desi2 T G 1: 178,256,604 M106R unknown Het
Dnaaf3 T C 7: 4,528,101 E111G probably damaging Het
Epha10 T A 4: 124,881,911 F13I probably benign Het
Fam193a T A 5: 34,458,027 F813L possibly damaging Het
Fbn1 C A 2: 125,365,631 A981S probably benign Het
Gga2 T A 7: 122,012,225 T37S probably damaging Het
Glra3 T A 8: 56,125,264 F452Y probably damaging Het
Gm10338 T A 14: 7,594,512 N96I probably damaging Het
Gm6502 G A 5: 94,317,065 V437I probably benign Het
Gpd2 A T 2: 57,305,854 E149V possibly damaging Het
Gpr137c T G 14: 45,278,772 L321* probably null Het
Gsdmc2 T C 15: 63,830,829 I196M probably benign Het
Habp2 A G 19: 56,306,821 D48G probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Hnrnpr G T 4: 136,336,304 V342F probably damaging Het
Hyal6 T A 6: 24,734,930 Y287* probably null Het
Igsf8 T C 1: 172,318,958 Y571H Het
Kalrn A G 16: 34,034,494 S1999P probably damaging Het
Lama2 T A 10: 27,001,174 N2672I probably benign Het
Lrrc7 T C 3: 158,161,468 R879G probably damaging Het
Lrwd1 T G 5: 136,131,559 H307P probably benign Het
Mau2 T C 8: 70,027,503 Y318C probably damaging Het
Med13 T C 11: 86,308,901 Q660R probably benign Het
Mepce G C 5: 137,785,497 P189R probably damaging Het
Mical3 T A 6: 121,024,797 N578I probably damaging Het
Mug1 T C 6: 121,884,676 S1366P probably damaging Het
Nol11 A T 11: 107,173,452 D511E possibly damaging Het
Obscn T A 11: 59,103,514 H1514L probably benign Het
Olfr1021-ps1 A T 2: 85,863,578 I56F probably damaging Het
Olfr1308 A G 2: 111,960,239 V278A possibly damaging Het
Olfr1464-ps1 G A 19: 13,282,194 T288I unknown Het
Olfr1537 T C 9: 39,238,329 T32A probably benign Het
Olfr168 C T 16: 19,530,276 A215T probably benign Het
Olfr854 T C 9: 19,567,100 I95V possibly damaging Het
Olfr860 A G 9: 19,846,520 L33P possibly damaging Het
Onecut3 C A 10: 80,496,053 S349* probably null Het
Patl2 C T 2: 122,124,893 G297E probably benign Het
Pdlim5 G A 3: 142,304,350 T168M probably damaging Het
Pdzd2 A C 15: 12,374,535 L1838R probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pkd1l3 T C 8: 109,669,217 V2083A probably damaging Het
Pkhd1 T A 1: 20,567,517 Y348F probably damaging Het
Plekhg5 T A 4: 152,114,369 S1005T probably benign Het
Ppp4r1 T A 17: 65,835,078 N709K probably null Het
Reln T C 5: 21,920,510 D2725G possibly damaging Het
Rnf41 T A 10: 128,438,430 I317K probably benign Het
Rxfp2 T C 5: 150,055,979 V268A possibly damaging Het
Sema5a A G 15: 32,679,227 H884R probably damaging Het
Serpinh1 A T 7: 99,347,277 M236K probably damaging Het
Sh3pxd2a A G 19: 47,267,171 L1064P probably damaging Het
Skint6 T C 4: 112,858,178 H947R probably benign Het
Slc12a3 T A 8: 94,357,030 M895K possibly damaging Het
Slc22a3 C A 17: 12,507,170 R52L probably damaging Het
Slc38a1 A G 15: 96,590,084 L180P probably damaging Het
Slc4a3 T C 1: 75,556,968 V1078A probably damaging Het
Snx30 T A 4: 59,879,241 V160E probably damaging Het
Spata18 A T 5: 73,672,497 I332F Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Svep1 T A 4: 58,084,144 Y1876F possibly damaging Het
Sytl1 A G 4: 133,258,980 probably null Het
Tacc2 A C 7: 130,764,311 K567Q probably damaging Het
Tfr2 A G 5: 137,577,507 D295G possibly damaging Het
Tmem53 C A 4: 117,267,925 H78Q probably benign Het
Tnnt2 G A 1: 135,840,902 E10K unknown Het
Top2a T A 11: 99,012,144 I406F probably damaging Het
Ttc1 C A 11: 43,730,478 R292I Het
Ubr1 T G 2: 120,873,146 T1568P probably damaging Het
Usp25 T G 16: 77,055,188 V197G probably damaging Het
Usp9y A T Y: 1,432,188 N432K probably benign Het
Vmn2r26 T A 6: 124,061,178 Y571N probably damaging Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126601872 missense probably benign 0.00
IGL01024:Hdc APN 2 126603846 missense probably benign 0.32
IGL01393:Hdc APN 2 126594661 missense probably benign 0.28
IGL01802:Hdc APN 2 126603894 missense probably benign 0.04
IGL01958:Hdc APN 2 126594532 missense possibly damaging 0.87
IGL02193:Hdc APN 2 126601780 splice site probably benign
IGL02494:Hdc APN 2 126594121 missense probably benign
IGL02696:Hdc APN 2 126594300 missense probably damaging 1.00
IGL02874:Hdc APN 2 126601676 missense probably benign 0.21
R0453:Hdc UTSW 2 126594951 splice site probably benign
R0528:Hdc UTSW 2 126616232 missense probably benign 0.00
R1337:Hdc UTSW 2 126616276 missense probably benign
R1862:Hdc UTSW 2 126597933 missense probably benign 0.36
R1938:Hdc UTSW 2 126606397 missense possibly damaging 0.86
R1994:Hdc UTSW 2 126616187 missense probably damaging 1.00
R2230:Hdc UTSW 2 126594018 missense possibly damaging 0.65
R2257:Hdc UTSW 2 126616080 splice site probably null
R2921:Hdc UTSW 2 126593990 missense probably damaging 1.00
R2923:Hdc UTSW 2 126593990 missense probably damaging 1.00
R3620:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3621:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3914:Hdc UTSW 2 126603006 missense probably damaging 1.00
R4076:Hdc UTSW 2 126616261 missense possibly damaging 0.92
R4114:Hdc UTSW 2 126601818 missense probably benign 0.16
R4213:Hdc UTSW 2 126597866 splice site probably null
R4827:Hdc UTSW 2 126594313 missense probably benign
R4889:Hdc UTSW 2 126594133 missense probably benign 0.00
R5013:Hdc UTSW 2 126604300 missense probably benign 0.33
R5593:Hdc UTSW 2 126618584 utr 5 prime probably benign
R5604:Hdc UTSW 2 126594663 missense probably benign
R5637:Hdc UTSW 2 126616189 missense probably benign 0.02
R6211:Hdc UTSW 2 126593977 missense probably damaging 0.98
R6312:Hdc UTSW 2 126607406 missense possibly damaging 0.65
R7730:Hdc UTSW 2 126594082 missense possibly damaging 0.51
R7889:Hdc UTSW 2 126616210 missense probably damaging 1.00
R8328:Hdc UTSW 2 126601883 missense probably damaging 1.00
R8482:Hdc UTSW 2 126594205 missense probably benign
R8517:Hdc UTSW 2 126597970 critical splice acceptor site probably null
R9136:Hdc UTSW 2 126597866 splice site probably null
R9139:Hdc UTSW 2 126597917 missense probably damaging 1.00
R9208:Hdc UTSW 2 126594680 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGCACTACAGGTCAGCACTG -3'
(R):5'- CTGTTCAAGAGGGACAGGTG -3'

Sequencing Primer
(F):5'- TACAGGTCAGCACTGGCACAAG -3'
(R):5'- GGACAGGTGTGACTAGGCC -3'
Posted On 2022-07-18