Mutagenetix > Incidental Mutation

Incidental Mutation 'R9515:Skint6'

718449

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R9515 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112858178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 947 (H947R)

Ref Sequence

ENSEMBL: ENSMUSP00000121870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably benign
Transcript: ENSMUST00000138966
AA Change: H947R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: H947R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171224
AA Change: H947R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: H947R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Aamdc	A	G	7: 97,575,601	V18A	probably benign	Het
Adam12	T	A	7: 133,907,644	I796F	probably benign	Het
Adcy7	T	A	8: 88,311,018	V238E	possibly damaging	Het
Adgrv1	G	A	13: 81,543,378	H1697Y	probably damaging	Het
Adrb1	A	G	19: 56,723,393	D341G	probably benign	Het
Akap13	T	C	7: 75,704,527	Y80H	probably benign	Het
Akap9	C	T	5: 4,055,709	L2927F	probably damaging	Het
Alox8	T	A	11: 69,185,124	D667V	probably damaging	Het
Arhgap30	A	G	1: 171,408,434	E792G	probably benign	Het
Arhgef16	A	G	4: 154,280,975	V561A	possibly damaging	Het
Bcap29	A	T	12: 31,626,757	Y105N	probably damaging	Het
Best2	T	A	8: 85,013,518	T6S		Het
Bfsp2	C	A	9: 103,480,052	V59L	possibly damaging	Het
Brd3	T	A	2: 27,459,803	D246V		Het
Btnl1	T	A	17: 34,381,144	V207E	probably benign	Het
C87499	T	A	4: 88,627,982	L374F	possibly damaging	Het
Ccdc122	T	A	14: 77,091,968	Y154N		Het
Cfap43	A	G	19: 47,785,375	Y656H	probably damaging	Het
Clca3a2	A	T	3: 144,803,047	Y670*	probably null	Het
Coprs	T	C	8: 13,885,081	Y158C	probably damaging	Het
Desi2	T	G	1: 178,256,604	M106R	unknown	Het
Dnaaf3	T	C	7: 4,528,101	E111G	probably damaging	Het
Epha10	T	A	4: 124,881,911	F13I	probably benign	Het
Fam193a	T	A	5: 34,458,027	F813L	possibly damaging	Het
Fbn1	C	A	2: 125,365,631	A981S	probably benign	Het
Gga2	T	A	7: 122,012,225	T37S	probably damaging	Het
Glra3	T	A	8: 56,125,264	F452Y	probably damaging	Het
Gm10338	T	A	14: 7,594,512	N96I	probably damaging	Het
Gm6502	G	A	5: 94,317,065	V437I	probably benign	Het
Gpd2	A	T	2: 57,305,854	E149V	possibly damaging	Het
Gpr137c	T	G	14: 45,278,772	L321*	probably null	Het
Gsdmc2	T	C	15: 63,830,829	I196M	probably benign	Het
Habp2	A	G	19: 56,306,821	D48G	probably benign	Het
Hdc	G	T	2: 126,616,229	P58T	probably damaging	Het
Heatr5a	AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA	AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA	12: 51,887,919		probably benign	Het
Hnrnpr	G	T	4: 136,336,304	V342F	probably damaging	Het
Hyal6	T	A	6: 24,734,930	Y287*	probably null	Het
Igsf8	T	C	1: 172,318,958	Y571H		Het
Kalrn	A	G	16: 34,034,494	S1999P	probably damaging	Het
Lama2	T	A	10: 27,001,174	N2672I	probably benign	Het
Lrrc7	T	C	3: 158,161,468	R879G	probably damaging	Het
Lrwd1	T	G	5: 136,131,559	H307P	probably benign	Het
Mau2	T	C	8: 70,027,503	Y318C	probably damaging	Het
Med13	T	C	11: 86,308,901	Q660R	probably benign	Het
Mepce	G	C	5: 137,785,497	P189R	probably damaging	Het
Mical3	T	A	6: 121,024,797	N578I	probably damaging	Het
Mug1	T	C	6: 121,884,676	S1366P	probably damaging	Het
Nol11	A	T	11: 107,173,452	D511E	possibly damaging	Het
Obscn	T	A	11: 59,103,514	H1514L	probably benign	Het
Olfr1021-ps1	A	T	2: 85,863,578	I56F	probably damaging	Het
Olfr1308	A	G	2: 111,960,239	V278A	possibly damaging	Het
Olfr1464-ps1	G	A	19: 13,282,194	T288I	unknown	Het
Olfr1537	T	C	9: 39,238,329	T32A	probably benign	Het
Olfr168	C	T	16: 19,530,276	A215T	probably benign	Het
Olfr854	T	C	9: 19,567,100	I95V	possibly damaging	Het
Olfr860	A	G	9: 19,846,520	L33P	possibly damaging	Het
Onecut3	C	A	10: 80,496,053	S349*	probably null	Het
Patl2	C	T	2: 122,124,893	G297E	probably benign	Het
Pdlim5	G	A	3: 142,304,350	T168M	probably damaging	Het
Pdzd2	A	C	15: 12,374,535	L1838R	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pkd1l3	T	C	8: 109,669,217	V2083A	probably damaging	Het
Pkhd1	T	A	1: 20,567,517	Y348F	probably damaging	Het
Plekhg5	T	A	4: 152,114,369	S1005T	probably benign	Het
Ppp4r1	T	A	17: 65,835,078	N709K	probably null	Het
Reln	T	C	5: 21,920,510	D2725G	possibly damaging	Het
Rnf41	T	A	10: 128,438,430	I317K	probably benign	Het
Rxfp2	T	C	5: 150,055,979	V268A	possibly damaging	Het
Sema5a	A	G	15: 32,679,227	H884R	probably damaging	Het
Serpinh1	A	T	7: 99,347,277	M236K	probably damaging	Het
Sh3pxd2a	A	G	19: 47,267,171	L1064P	probably damaging	Het
Slc12a3	T	A	8: 94,357,030	M895K	possibly damaging	Het
Slc22a3	C	A	17: 12,507,170	R52L	probably damaging	Het
Slc38a1	A	G	15: 96,590,084	L180P	probably damaging	Het
Slc4a3	T	C	1: 75,556,968	V1078A	probably damaging	Het
Snx30	T	A	4: 59,879,241	V160E	probably damaging	Het
Spata18	A	T	5: 73,672,497	I332F		Het
Stard9	C	G	2: 120,704,083	P3607R	probably damaging	Het
Svep1	T	A	4: 58,084,144	Y1876F	possibly damaging	Het
Sytl1	A	G	4: 133,258,980		probably null	Het
Tacc2	A	C	7: 130,764,311	K567Q	probably damaging	Het
Tfr2	A	G	5: 137,577,507	D295G	possibly damaging	Het
Tmem53	C	A	4: 117,267,925	H78Q	probably benign	Het
Tnnt2	G	A	1: 135,840,902	E10K	unknown	Het
Top2a	T	A	11: 99,012,144	I406F	probably damaging	Het
Ttc1	C	A	11: 43,730,478	R292I		Het
Ubr1	T	G	2: 120,873,146	T1568P	probably damaging	Het
Usp25	T	G	16: 77,055,188	V197G	probably damaging	Het
Usp9y	A	T	Y: 1,432,188	N432K	probably benign	Het
Vmn2r26	T	A	6: 124,061,178	Y571N	probably damaging	Het
Zfp7	T	C	15: 76,891,284	S509P	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAAGTCAGTGATAACTTAGGACTTCT -3'
(R):5'- TTCCCCTTGTGAGCCAGAAAAG -3'

Sequencing Primer
(F):5'- ACTTTTTAAAGGGCCACTCCTAG -3'
(R):5'- CAAATCTAATAGGTGCTACTGCTGGC -3'

Posted On

2022-07-18