Incidental Mutation 'R9515:Skint6'
ID 718449
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112715375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 947 (H947R)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: H947R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: H947R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: H947R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: H947R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aamdc A G 7: 97,224,808 (GRCm39) V18A probably benign Het
Adam12 T A 7: 133,509,373 (GRCm39) I796F probably benign Het
Adcy7 T A 8: 89,037,646 (GRCm39) V238E possibly damaging Het
Adgrv1 G A 13: 81,691,497 (GRCm39) H1697Y probably damaging Het
Adrb1 A G 19: 56,711,825 (GRCm39) D341G probably benign Het
Akap13 T C 7: 75,354,275 (GRCm39) Y80H probably benign Het
Akap9 C T 5: 4,105,709 (GRCm39) L2927F probably damaging Het
Alox8 T A 11: 69,075,950 (GRCm39) D667V probably damaging Het
Arhgap30 A G 1: 171,236,002 (GRCm39) E792G probably benign Het
Arhgef16 A G 4: 154,365,432 (GRCm39) V561A possibly damaging Het
Bcap29 A T 12: 31,676,756 (GRCm39) Y105N probably damaging Het
Best2 T A 8: 85,740,147 (GRCm39) T6S Het
Bfsp2 C A 9: 103,357,251 (GRCm39) V59L possibly damaging Het
Brd3 T A 2: 27,349,815 (GRCm39) D246V Het
Btnl1 T A 17: 34,600,118 (GRCm39) V207E probably benign Het
Ccdc122 T A 14: 77,329,408 (GRCm39) Y154N Het
Cfap43 A G 19: 47,773,814 (GRCm39) Y656H probably damaging Het
Clca3a2 A T 3: 144,508,808 (GRCm39) Y670* probably null Het
Coprs T C 8: 13,935,081 (GRCm39) Y158C probably damaging Het
Desi2 T G 1: 178,084,170 (GRCm39) M106R unknown Het
Dnaaf3 T C 7: 4,531,100 (GRCm39) E111G probably damaging Het
Epha10 T A 4: 124,775,704 (GRCm39) F13I probably benign Het
Fam193a T A 5: 34,615,371 (GRCm39) F813L possibly damaging Het
Fbn1 C A 2: 125,207,551 (GRCm39) A981S probably benign Het
Gga2 T A 7: 121,611,448 (GRCm39) T37S probably damaging Het
Glra3 T A 8: 56,578,299 (GRCm39) F452Y probably damaging Het
Gm10338 T A 14: 19,280,438 (GRCm39) N96I probably damaging Het
Gpd2 A T 2: 57,195,866 (GRCm39) E149V possibly damaging Het
Gpr137c T G 14: 45,516,229 (GRCm39) L321* probably null Het
Gsdmc2 T C 15: 63,702,678 (GRCm39) I196M probably benign Het
Habp2 A G 19: 56,295,253 (GRCm39) D48G probably benign Het
Hdc G T 2: 126,458,149 (GRCm39) P58T probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Hnrnpr G T 4: 136,063,615 (GRCm39) V342F probably damaging Het
Hyal6 T A 6: 24,734,929 (GRCm39) Y287* probably null Het
Igsf8 T C 1: 172,146,525 (GRCm39) Y571H Het
Kalrn A G 16: 33,854,864 (GRCm39) S1999P probably damaging Het
Lama2 T A 10: 26,877,170 (GRCm39) N2672I probably benign Het
Lrrc7 T C 3: 157,867,105 (GRCm39) R879G probably damaging Het
Lrwd1 T G 5: 136,160,413 (GRCm39) H307P probably benign Het
Mau2 T C 8: 70,480,153 (GRCm39) Y318C probably damaging Het
Med13 T C 11: 86,199,727 (GRCm39) Q660R probably benign Het
Mepce G C 5: 137,783,759 (GRCm39) P189R probably damaging Het
Mical3 T A 6: 121,001,758 (GRCm39) N578I probably damaging Het
Mug1 T C 6: 121,861,635 (GRCm39) S1366P probably damaging Het
Nol11 A T 11: 107,064,278 (GRCm39) D511E possibly damaging Het
Obscn T A 11: 58,994,340 (GRCm39) H1514L probably benign Het
Onecut3 C A 10: 80,331,887 (GRCm39) S349* probably null Het
Or2l13b C T 16: 19,349,026 (GRCm39) A215T probably benign Het
Or4f57 A G 2: 111,790,584 (GRCm39) V278A possibly damaging Het
Or5ap2b-ps1 A T 2: 85,693,922 (GRCm39) I56F probably damaging Het
Or5b110-ps1 G A 19: 13,259,558 (GRCm39) T288I unknown Het
Or7e169 A G 9: 19,757,816 (GRCm39) L33P possibly damaging Het
Or7g34 T C 9: 19,478,396 (GRCm39) I95V possibly damaging Het
Or8g18 T C 9: 39,149,625 (GRCm39) T32A probably benign Het
Patl2 C T 2: 121,955,374 (GRCm39) G297E probably benign Het
Pdlim5 G A 3: 142,010,111 (GRCm39) T168M probably damaging Het
Pdzd2 A C 15: 12,374,621 (GRCm39) L1838R probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pkd1l3 T C 8: 110,395,849 (GRCm39) V2083A probably damaging Het
Pkhd1 T A 1: 20,637,741 (GRCm39) Y348F probably damaging Het
Plekhg5 T A 4: 152,198,826 (GRCm39) S1005T probably benign Het
Ppp4r1 T A 17: 66,142,073 (GRCm39) N709K probably null Het
Pramel32 T A 4: 88,546,219 (GRCm39) L374F possibly damaging Het
Pramel40 G A 5: 94,464,924 (GRCm39) V437I probably benign Het
Reln T C 5: 22,125,508 (GRCm39) D2725G possibly damaging Het
Rnf41 T A 10: 128,274,299 (GRCm39) I317K probably benign Het
Rxfp2 T C 5: 149,979,444 (GRCm39) V268A possibly damaging Het
Sema5a A G 15: 32,679,373 (GRCm39) H884R probably damaging Het
Serpinh1 A T 7: 98,996,484 (GRCm39) M236K probably damaging Het
Sh3pxd2a A G 19: 47,255,610 (GRCm39) L1064P probably damaging Het
Slc12a3 T A 8: 95,083,658 (GRCm39) M895K possibly damaging Het
Slc22a3 C A 17: 12,726,057 (GRCm39) R52L probably damaging Het
Slc38a1 A G 15: 96,487,965 (GRCm39) L180P probably damaging Het
Slc4a3 T C 1: 75,533,612 (GRCm39) V1078A probably damaging Het
Snx30 T A 4: 59,879,241 (GRCm39) V160E probably damaging Het
Spata18 A T 5: 73,829,840 (GRCm39) I332F Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Svep1 T A 4: 58,084,144 (GRCm39) Y1876F possibly damaging Het
Sytl1 A G 4: 132,986,291 (GRCm39) probably null Het
Tacc2 A C 7: 130,366,041 (GRCm39) K567Q probably damaging Het
Tfr2 A G 5: 137,575,769 (GRCm39) D295G possibly damaging Het
Tmem53 C A 4: 117,125,122 (GRCm39) H78Q probably benign Het
Tnnt2 G A 1: 135,768,640 (GRCm39) E10K unknown Het
Top2a T A 11: 98,902,970 (GRCm39) I406F probably damaging Het
Ttc1 C A 11: 43,621,305 (GRCm39) R292I Het
Ubr1 T G 2: 120,703,627 (GRCm39) T1568P probably damaging Het
Usp25 T G 16: 76,852,076 (GRCm39) V197G probably damaging Het
Usp9y A T Y: 1,432,188 (GRCm39) N432K probably benign Het
Vmn2r26 T A 6: 124,038,137 (GRCm39) Y571N probably damaging Het
Zfp7 T C 15: 76,775,484 (GRCm39) S509P probably damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAAGTCAGTGATAACTTAGGACTTCT -3'
(R):5'- TTCCCCTTGTGAGCCAGAAAAG -3'

Sequencing Primer
(F):5'- ACTTTTTAAAGGGCCACTCCTAG -3'
(R):5'- CAAATCTAATAGGTGCTACTGCTGGC -3'
Posted On 2022-07-18