Incidental Mutation 'R9515:Vmn2r26'
ID 718469
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124038137 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 571 (Y571N)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: Y571N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: Y571N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aamdc A G 7: 97,224,808 (GRCm39) V18A probably benign Het
Adam12 T A 7: 133,509,373 (GRCm39) I796F probably benign Het
Adcy7 T A 8: 89,037,646 (GRCm39) V238E possibly damaging Het
Adgrv1 G A 13: 81,691,497 (GRCm39) H1697Y probably damaging Het
Adrb1 A G 19: 56,711,825 (GRCm39) D341G probably benign Het
Akap13 T C 7: 75,354,275 (GRCm39) Y80H probably benign Het
Akap9 C T 5: 4,105,709 (GRCm39) L2927F probably damaging Het
Alox8 T A 11: 69,075,950 (GRCm39) D667V probably damaging Het
Arhgap30 A G 1: 171,236,002 (GRCm39) E792G probably benign Het
Arhgef16 A G 4: 154,365,432 (GRCm39) V561A possibly damaging Het
Bcap29 A T 12: 31,676,756 (GRCm39) Y105N probably damaging Het
Best2 T A 8: 85,740,147 (GRCm39) T6S Het
Bfsp2 C A 9: 103,357,251 (GRCm39) V59L possibly damaging Het
Brd3 T A 2: 27,349,815 (GRCm39) D246V Het
Btnl1 T A 17: 34,600,118 (GRCm39) V207E probably benign Het
Ccdc122 T A 14: 77,329,408 (GRCm39) Y154N Het
Cfap43 A G 19: 47,773,814 (GRCm39) Y656H probably damaging Het
Clca3a2 A T 3: 144,508,808 (GRCm39) Y670* probably null Het
Coprs T C 8: 13,935,081 (GRCm39) Y158C probably damaging Het
Desi2 T G 1: 178,084,170 (GRCm39) M106R unknown Het
Dnaaf3 T C 7: 4,531,100 (GRCm39) E111G probably damaging Het
Epha10 T A 4: 124,775,704 (GRCm39) F13I probably benign Het
Fam193a T A 5: 34,615,371 (GRCm39) F813L possibly damaging Het
Fbn1 C A 2: 125,207,551 (GRCm39) A981S probably benign Het
Gga2 T A 7: 121,611,448 (GRCm39) T37S probably damaging Het
Glra3 T A 8: 56,578,299 (GRCm39) F452Y probably damaging Het
Gm10338 T A 14: 19,280,438 (GRCm39) N96I probably damaging Het
Gpd2 A T 2: 57,195,866 (GRCm39) E149V possibly damaging Het
Gpr137c T G 14: 45,516,229 (GRCm39) L321* probably null Het
Gsdmc2 T C 15: 63,702,678 (GRCm39) I196M probably benign Het
Habp2 A G 19: 56,295,253 (GRCm39) D48G probably benign Het
Hdc G T 2: 126,458,149 (GRCm39) P58T probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Hnrnpr G T 4: 136,063,615 (GRCm39) V342F probably damaging Het
Hyal6 T A 6: 24,734,929 (GRCm39) Y287* probably null Het
Igsf8 T C 1: 172,146,525 (GRCm39) Y571H Het
Kalrn A G 16: 33,854,864 (GRCm39) S1999P probably damaging Het
Lama2 T A 10: 26,877,170 (GRCm39) N2672I probably benign Het
Lrrc7 T C 3: 157,867,105 (GRCm39) R879G probably damaging Het
Lrwd1 T G 5: 136,160,413 (GRCm39) H307P probably benign Het
Mau2 T C 8: 70,480,153 (GRCm39) Y318C probably damaging Het
Med13 T C 11: 86,199,727 (GRCm39) Q660R probably benign Het
Mepce G C 5: 137,783,759 (GRCm39) P189R probably damaging Het
Mical3 T A 6: 121,001,758 (GRCm39) N578I probably damaging Het
Mug1 T C 6: 121,861,635 (GRCm39) S1366P probably damaging Het
Nol11 A T 11: 107,064,278 (GRCm39) D511E possibly damaging Het
Obscn T A 11: 58,994,340 (GRCm39) H1514L probably benign Het
Onecut3 C A 10: 80,331,887 (GRCm39) S349* probably null Het
Or2l13b C T 16: 19,349,026 (GRCm39) A215T probably benign Het
Or4f57 A G 2: 111,790,584 (GRCm39) V278A possibly damaging Het
Or5ap2b-ps1 A T 2: 85,693,922 (GRCm39) I56F probably damaging Het
Or5b110-ps1 G A 19: 13,259,558 (GRCm39) T288I unknown Het
Or7e169 A G 9: 19,757,816 (GRCm39) L33P possibly damaging Het
Or7g34 T C 9: 19,478,396 (GRCm39) I95V possibly damaging Het
Or8g18 T C 9: 39,149,625 (GRCm39) T32A probably benign Het
Patl2 C T 2: 121,955,374 (GRCm39) G297E probably benign Het
Pdlim5 G A 3: 142,010,111 (GRCm39) T168M probably damaging Het
Pdzd2 A C 15: 12,374,621 (GRCm39) L1838R probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pkd1l3 T C 8: 110,395,849 (GRCm39) V2083A probably damaging Het
Pkhd1 T A 1: 20,637,741 (GRCm39) Y348F probably damaging Het
Plekhg5 T A 4: 152,198,826 (GRCm39) S1005T probably benign Het
Ppp4r1 T A 17: 66,142,073 (GRCm39) N709K probably null Het
Pramel32 T A 4: 88,546,219 (GRCm39) L374F possibly damaging Het
Pramel40 G A 5: 94,464,924 (GRCm39) V437I probably benign Het
Reln T C 5: 22,125,508 (GRCm39) D2725G possibly damaging Het
Rnf41 T A 10: 128,274,299 (GRCm39) I317K probably benign Het
Rxfp2 T C 5: 149,979,444 (GRCm39) V268A possibly damaging Het
Sema5a A G 15: 32,679,373 (GRCm39) H884R probably damaging Het
Serpinh1 A T 7: 98,996,484 (GRCm39) M236K probably damaging Het
Sh3pxd2a A G 19: 47,255,610 (GRCm39) L1064P probably damaging Het
Skint6 T C 4: 112,715,375 (GRCm39) H947R probably benign Het
Slc12a3 T A 8: 95,083,658 (GRCm39) M895K possibly damaging Het
Slc22a3 C A 17: 12,726,057 (GRCm39) R52L probably damaging Het
Slc38a1 A G 15: 96,487,965 (GRCm39) L180P probably damaging Het
Slc4a3 T C 1: 75,533,612 (GRCm39) V1078A probably damaging Het
Snx30 T A 4: 59,879,241 (GRCm39) V160E probably damaging Het
Spata18 A T 5: 73,829,840 (GRCm39) I332F Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Svep1 T A 4: 58,084,144 (GRCm39) Y1876F possibly damaging Het
Sytl1 A G 4: 132,986,291 (GRCm39) probably null Het
Tacc2 A C 7: 130,366,041 (GRCm39) K567Q probably damaging Het
Tfr2 A G 5: 137,575,769 (GRCm39) D295G possibly damaging Het
Tmem53 C A 4: 117,125,122 (GRCm39) H78Q probably benign Het
Tnnt2 G A 1: 135,768,640 (GRCm39) E10K unknown Het
Top2a T A 11: 98,902,970 (GRCm39) I406F probably damaging Het
Ttc1 C A 11: 43,621,305 (GRCm39) R292I Het
Ubr1 T G 2: 120,703,627 (GRCm39) T1568P probably damaging Het
Usp25 T G 16: 76,852,076 (GRCm39) V197G probably damaging Het
Usp9y A T Y: 1,432,188 (GRCm39) N432K probably benign Het
Zfp7 T C 15: 76,775,484 (GRCm39) S509P probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATACTCTGATTGTTCAAGTCCAC -3'
(R):5'- GCTCTGACAATGGGTGTTTC -3'

Sequencing Primer
(F):5'- GATTGTTCAAGTCCACCTACTTTCTG -3'
(R):5'- ACAATGGGTGTTTCTCGATAGCAG -3'
Posted On 2022-07-18