Incidental Mutation 'R9515:Btnl1'
ID 718513
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34600118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 207 (V207E)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably benign
Transcript: ENSMUST00000080254
AA Change: V207E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: V207E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aamdc A G 7: 97,224,808 (GRCm39) V18A probably benign Het
Adam12 T A 7: 133,509,373 (GRCm39) I796F probably benign Het
Adcy7 T A 8: 89,037,646 (GRCm39) V238E possibly damaging Het
Adgrv1 G A 13: 81,691,497 (GRCm39) H1697Y probably damaging Het
Adrb1 A G 19: 56,711,825 (GRCm39) D341G probably benign Het
Akap13 T C 7: 75,354,275 (GRCm39) Y80H probably benign Het
Akap9 C T 5: 4,105,709 (GRCm39) L2927F probably damaging Het
Alox8 T A 11: 69,075,950 (GRCm39) D667V probably damaging Het
Arhgap30 A G 1: 171,236,002 (GRCm39) E792G probably benign Het
Arhgef16 A G 4: 154,365,432 (GRCm39) V561A possibly damaging Het
Bcap29 A T 12: 31,676,756 (GRCm39) Y105N probably damaging Het
Best2 T A 8: 85,740,147 (GRCm39) T6S Het
Bfsp2 C A 9: 103,357,251 (GRCm39) V59L possibly damaging Het
Brd3 T A 2: 27,349,815 (GRCm39) D246V Het
Ccdc122 T A 14: 77,329,408 (GRCm39) Y154N Het
Cfap43 A G 19: 47,773,814 (GRCm39) Y656H probably damaging Het
Clca3a2 A T 3: 144,508,808 (GRCm39) Y670* probably null Het
Coprs T C 8: 13,935,081 (GRCm39) Y158C probably damaging Het
Desi2 T G 1: 178,084,170 (GRCm39) M106R unknown Het
Dnaaf3 T C 7: 4,531,100 (GRCm39) E111G probably damaging Het
Epha10 T A 4: 124,775,704 (GRCm39) F13I probably benign Het
Fam193a T A 5: 34,615,371 (GRCm39) F813L possibly damaging Het
Fbn1 C A 2: 125,207,551 (GRCm39) A981S probably benign Het
Gga2 T A 7: 121,611,448 (GRCm39) T37S probably damaging Het
Glra3 T A 8: 56,578,299 (GRCm39) F452Y probably damaging Het
Gm10338 T A 14: 19,280,438 (GRCm39) N96I probably damaging Het
Gpd2 A T 2: 57,195,866 (GRCm39) E149V possibly damaging Het
Gpr137c T G 14: 45,516,229 (GRCm39) L321* probably null Het
Gsdmc2 T C 15: 63,702,678 (GRCm39) I196M probably benign Het
Habp2 A G 19: 56,295,253 (GRCm39) D48G probably benign Het
Hdc G T 2: 126,458,149 (GRCm39) P58T probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Hnrnpr G T 4: 136,063,615 (GRCm39) V342F probably damaging Het
Hyal6 T A 6: 24,734,929 (GRCm39) Y287* probably null Het
Igsf8 T C 1: 172,146,525 (GRCm39) Y571H Het
Kalrn A G 16: 33,854,864 (GRCm39) S1999P probably damaging Het
Lama2 T A 10: 26,877,170 (GRCm39) N2672I probably benign Het
Lrrc7 T C 3: 157,867,105 (GRCm39) R879G probably damaging Het
Lrwd1 T G 5: 136,160,413 (GRCm39) H307P probably benign Het
Mau2 T C 8: 70,480,153 (GRCm39) Y318C probably damaging Het
Med13 T C 11: 86,199,727 (GRCm39) Q660R probably benign Het
Mepce G C 5: 137,783,759 (GRCm39) P189R probably damaging Het
Mical3 T A 6: 121,001,758 (GRCm39) N578I probably damaging Het
Mug1 T C 6: 121,861,635 (GRCm39) S1366P probably damaging Het
Nol11 A T 11: 107,064,278 (GRCm39) D511E possibly damaging Het
Obscn T A 11: 58,994,340 (GRCm39) H1514L probably benign Het
Onecut3 C A 10: 80,331,887 (GRCm39) S349* probably null Het
Or2l13b C T 16: 19,349,026 (GRCm39) A215T probably benign Het
Or4f57 A G 2: 111,790,584 (GRCm39) V278A possibly damaging Het
Or5ap2b-ps1 A T 2: 85,693,922 (GRCm39) I56F probably damaging Het
Or5b110-ps1 G A 19: 13,259,558 (GRCm39) T288I unknown Het
Or7e169 A G 9: 19,757,816 (GRCm39) L33P possibly damaging Het
Or7g34 T C 9: 19,478,396 (GRCm39) I95V possibly damaging Het
Or8g18 T C 9: 39,149,625 (GRCm39) T32A probably benign Het
Patl2 C T 2: 121,955,374 (GRCm39) G297E probably benign Het
Pdlim5 G A 3: 142,010,111 (GRCm39) T168M probably damaging Het
Pdzd2 A C 15: 12,374,621 (GRCm39) L1838R probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pkd1l3 T C 8: 110,395,849 (GRCm39) V2083A probably damaging Het
Pkhd1 T A 1: 20,637,741 (GRCm39) Y348F probably damaging Het
Plekhg5 T A 4: 152,198,826 (GRCm39) S1005T probably benign Het
Ppp4r1 T A 17: 66,142,073 (GRCm39) N709K probably null Het
Pramel32 T A 4: 88,546,219 (GRCm39) L374F possibly damaging Het
Pramel40 G A 5: 94,464,924 (GRCm39) V437I probably benign Het
Reln T C 5: 22,125,508 (GRCm39) D2725G possibly damaging Het
Rnf41 T A 10: 128,274,299 (GRCm39) I317K probably benign Het
Rxfp2 T C 5: 149,979,444 (GRCm39) V268A possibly damaging Het
Sema5a A G 15: 32,679,373 (GRCm39) H884R probably damaging Het
Serpinh1 A T 7: 98,996,484 (GRCm39) M236K probably damaging Het
Sh3pxd2a A G 19: 47,255,610 (GRCm39) L1064P probably damaging Het
Skint6 T C 4: 112,715,375 (GRCm39) H947R probably benign Het
Slc12a3 T A 8: 95,083,658 (GRCm39) M895K possibly damaging Het
Slc22a3 C A 17: 12,726,057 (GRCm39) R52L probably damaging Het
Slc38a1 A G 15: 96,487,965 (GRCm39) L180P probably damaging Het
Slc4a3 T C 1: 75,533,612 (GRCm39) V1078A probably damaging Het
Snx30 T A 4: 59,879,241 (GRCm39) V160E probably damaging Het
Spata18 A T 5: 73,829,840 (GRCm39) I332F Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Svep1 T A 4: 58,084,144 (GRCm39) Y1876F possibly damaging Het
Sytl1 A G 4: 132,986,291 (GRCm39) probably null Het
Tacc2 A C 7: 130,366,041 (GRCm39) K567Q probably damaging Het
Tfr2 A G 5: 137,575,769 (GRCm39) D295G possibly damaging Het
Tmem53 C A 4: 117,125,122 (GRCm39) H78Q probably benign Het
Tnnt2 G A 1: 135,768,640 (GRCm39) E10K unknown Het
Top2a T A 11: 98,902,970 (GRCm39) I406F probably damaging Het
Ttc1 C A 11: 43,621,305 (GRCm39) R292I Het
Ubr1 T G 2: 120,703,627 (GRCm39) T1568P probably damaging Het
Usp25 T G 16: 76,852,076 (GRCm39) V197G probably damaging Het
Usp9y A T Y: 1,432,188 (GRCm39) N432K probably benign Het
Vmn2r26 T A 6: 124,038,137 (GRCm39) Y571N probably damaging Het
Zfp7 T C 15: 76,775,484 (GRCm39) S509P probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0371:Btnl1 UTSW 17 34,600,031 (GRCm39) missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34,598,578 (GRCm39) missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34,604,608 (GRCm39) missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34,598,725 (GRCm39) missense probably null 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9528:Btnl1 UTSW 17 34,603,352 (GRCm39) missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCTCAAGATTGTGTCTTC -3'
(R):5'- TGGACAGTCAGAAACCAGCC -3'

Sequencing Primer
(F):5'- AAGATTGTGTCTTCTCTCCTCAGG -3'
(R):5'- GTCAGAAACCAGCCCGGAG -3'
Posted On 2022-07-18