Mutagenetix > Incidental Mutation

Incidental Mutation 'R9516:Trip12'

718524

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84757494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 932 (V932E)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: V932E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: V932E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: V932E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: V932E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: V899E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: V899E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186894
AA Change: V932E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: V932E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3300002I08Rik	T	C	2: 150,311,202	N88D	possibly damaging	Het
4933430I17Rik	A	G	4: 62,542,679	I264V	probably benign	Het
Abcc8	A	G	7: 46,138,005	F591L	probably benign	Het
Abr	G	T	11: 76,419,832	T810K	probably damaging	Het
Abracl	T	C	10: 18,018,883	E6G	unknown	Het
Adamts3	A	T	5: 89,686,891	Y871N	probably damaging	Het
Akap13	T	C	7: 75,704,527	Y80H	probably benign	Het
Alas1	A	G	9: 106,238,641		probably null	Het
Anapc1	A	C	2: 128,675,713	L337R	possibly damaging	Het
Apaf1	T	C	10: 91,079,954	Y24C	probably damaging	Het
Arhgef16	A	G	4: 154,280,975	V561A	possibly damaging	Het
Atp10b	T	A	11: 43,230,397	H962Q	probably benign	Het
BC067074	A	T	13: 113,319,115	N565I		Het
Brsk2	A	G	7: 141,993,115	T432A	probably benign	Het
C1rl	T	A	6: 124,508,843	V391E	probably damaging	Het
Caps2	A	T	10: 112,200,732	H399L	probably benign	Het
Ccdc43	C	A	11: 102,686,381	K199N	probably benign	Het
Ccdc7a	G	T	8: 128,829,293	P1198T	unknown	Het
Cct7	A	G	6: 85,467,643	Y423C	possibly damaging	Het
Cep112	A	G	11: 108,757,688	T783A	probably damaging	Het
Cep250	A	G	2: 155,991,539	T1795A	probably benign	Het
Clasp1	T	G	1: 118,503,830	S397A	possibly damaging	Het
Clock	A	C	5: 76,229,380	F691V	possibly damaging	Het
Cmklr1	A	G	5: 113,614,280	V220A	probably benign	Het
Coro2b	A	T	9: 62,428,009	Y298*	probably null	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Dlk2	G	A	17: 46,302,506	G186D	probably damaging	Het
Dok1	T	C	6: 83,032,991	K46E	probably damaging	Het
Dok3	A	G	13: 55,524,373	I164T	probably benign	Het
Ercc5	T	A	1: 44,167,881	D651E	probably damaging	Het
Erp27	T	C	6: 136,908,068	K244R	probably benign	Het
Fam160a1	G	A	3: 85,673,252	Q549*	probably null	Het
Flvcr2	T	C	12: 85,747,180	V110A	possibly damaging	Het
Gm3376	T	A	Y: 3,774,888	F28L	probably damaging	Het
Gsta3	T	C	1: 21,249,836	L22P	probably damaging	Het
Hdac5	T	C	11: 102,202,696	T493A	probably benign	Het
Hivep2	T	A	10: 14,129,779	I707N	probably benign	Het
Hmox1	A	G	8: 75,096,916	N71D	probably benign	Het
Hnrnpr	G	T	4: 136,336,304	V342F	probably damaging	Het
Ifi44	T	C	3: 151,732,471	D393G	probably damaging	Het
Ighv1-82	A	T	12: 115,952,946	F9I	probably damaging	Het
Kalrn	A	G	16: 34,034,494	S1999P	probably damaging	Het
Kcnq2	A	G	2: 181,134,960	S45P	probably benign	Het
Krt77	A	T	15: 101,861,344	Y364N	probably damaging	Het
Kti12	T	C	4: 108,848,279	V130A	probably benign	Het
Lama2	T	C	10: 27,224,019	E830G	probably benign	Het
Lrrn1	T	A	6: 107,568,544	H434Q	probably benign	Het
Med13	A	T	11: 86,288,975	N1382K	probably benign	Het
Mrpl42	A	G	10: 95,496,822		probably null	Het
Mtor	A	G	4: 148,484,646	D1140G	probably benign	Het
Mtrr	A	G	13: 68,572,636	I280T	probably benign	Het
Myh4	A	T	11: 67,248,464	I536F	probably damaging	Het
Myh4	T	A	11: 67,250,303	N730K	probably damaging	Het
Nat10	A	C	2: 103,733,019	L545R	probably damaging	Het
Nav3	T	A	10: 109,684,154	D2356V	probably damaging	Het
Nbea	A	T	3: 56,029,945	S748R	probably damaging	Het
Nlrp1a	T	C	11: 71,107,662	T904A	probably benign	Het
Nod2	A	T	8: 88,670,422	N820I	probably damaging	Het
Nptx1	A	G	11: 119,542,555	V406A	probably damaging	Het
Nrd1	T	A	4: 109,044,666	I644K	probably benign	Het
Olfr1508	T	C	14: 52,463,416	I198V	probably benign	Het
Ostf1	T	A	19: 18,596,371	I38F	probably benign	Het
Pde4b	G	T	4: 102,604,986	D605Y	probably damaging	Het
Pde4d	A	G	13: 109,260,662	T3A		Het
Pknox1	A	G	17: 31,603,209	I317V	probably damaging	Het
Plekhh2	A	G	17: 84,610,812	N1283S	probably benign	Het
Ppp3cb	G	A	14: 20,523,800	A289V	probably damaging	Het
Prag1	A	G	8: 36,140,054	D983G	probably damaging	Het
Psmd13	C	T	7: 140,898,542	T62M		Het
Rab42	C	T	4: 132,302,579	V111I		Het
Rabl2	T	A	15: 89,590,428		probably null	Het
Rapgef6	T	A	11: 54,691,343	S1365R	probably damaging	Het
Rassf4	G	T	6: 116,640,304	H247N	possibly damaging	Het
Rbfox1	A	G	16: 7,409,709	T363A	probably benign	Het
Sbf1	T	C	15: 89,300,539	D1091G	probably damaging	Het
Scaper	A	G	9: 55,685,991	V454A	probably benign	Het
Selenbp2	G	A	3: 94,700,045	D258N	probably benign	Het
Sirpa	A	T	2: 129,615,635	I210F	probably damaging	Het
Skint4	T	C	4: 112,158,039	S434P	probably benign	Het
Slc26a5	G	A	5: 21,811,339	Q682*	probably null	Het
Slco4a1	C	T	2: 180,474,150	S693F	possibly damaging	Het
Smpd3	A	G	8: 106,265,487	F145L	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Spata31d1c	A	T	13: 65,036,226	L527F	probably damaging	Het
Srd5a3	A	G	5: 76,149,947	N199D	probably benign	Het
Stard9	C	G	2: 120,704,083	P3607R	probably damaging	Het
Sytl1	A	G	4: 133,258,980		probably null	Het
Tas2r126	A	G	6: 42,435,373	H280R	probably null	Het
Tcf4	C	T	18: 69,519,873		probably benign	Het
Tlcd2	A	G	11: 75,468,286	T28A	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem119	A	G	5: 113,795,206	L178P	probably damaging	Het
Tmem206	G	A	1: 191,349,807	R337Q	probably damaging	Het
Tmprss7	T	C	16: 45,664,201	D532G	probably benign	Het
Tnfaip8l3	A	G	9: 54,027,493	I66T	probably benign	Het
Tor1b	A	G	2: 30,953,173	Y50C	probably damaging	Het
Tpp2	T	A	1: 43,978,488	S751T	probably benign	Het
Tpra1	T	C	6: 88,910,239	V193A	probably benign	Het
Ttn	T	A	2: 76,946,760	T1479S	unknown	Het
Unc13c	A	T	9: 73,484,938	V2044D	probably damaging	Het
Usp25	T	G	16: 77,055,188	V197G	probably damaging	Het
Vmn2r34	A	G	7: 7,672,367	V674A	probably benign	Het
Zfp7	T	C	15: 76,891,284	S509P	probably damaging	Het
Zfp821	A	G	8: 109,721,224	T66A	probably damaging	Het
Zfp97	T	A	17: 17,145,668	N476K	possibly damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTGCACAGATAATGCTTTCC -3'
(R):5'- TCAAGGTGTGTTCATGGAAATG -3'

Sequencing Primer
(F):5'- GTGCACAGATAATGCTTTCCTTATAG -3'
(R):5'- GTGTGTTCATGGAAATGGTAAAAATG -3'

Posted On

2022-07-18