Incidental Mutation 'R9516:Nbea'
ID 718537
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
Accession Numbers

Genbank: NM_030595

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55625195-56183701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56029945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 748 (S748R)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029374
AA Change: S748R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: S748R

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik T C 2: 150,311,202 N88D possibly damaging Het
4933430I17Rik A G 4: 62,542,679 I264V probably benign Het
Abcc8 A G 7: 46,138,005 F591L probably benign Het
Abr G T 11: 76,419,832 T810K probably damaging Het
Abracl T C 10: 18,018,883 E6G unknown Het
Adamts3 A T 5: 89,686,891 Y871N probably damaging Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Alas1 A G 9: 106,238,641 probably null Het
Anapc1 A C 2: 128,675,713 L337R possibly damaging Het
Apaf1 T C 10: 91,079,954 Y24C probably damaging Het
Arhgef16 A G 4: 154,280,975 V561A possibly damaging Het
Atp10b T A 11: 43,230,397 H962Q probably benign Het
BC067074 A T 13: 113,319,115 N565I Het
Brsk2 A G 7: 141,993,115 T432A probably benign Het
C1rl T A 6: 124,508,843 V391E probably damaging Het
Caps2 A T 10: 112,200,732 H399L probably benign Het
Ccdc43 C A 11: 102,686,381 K199N probably benign Het
Ccdc7a G T 8: 128,829,293 P1198T unknown Het
Cct7 A G 6: 85,467,643 Y423C possibly damaging Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep250 A G 2: 155,991,539 T1795A probably benign Het
Clasp1 T G 1: 118,503,830 S397A possibly damaging Het
Clock A C 5: 76,229,380 F691V possibly damaging Het
Cmklr1 A G 5: 113,614,280 V220A probably benign Het
Coro2b A T 9: 62,428,009 Y298* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dlk2 G A 17: 46,302,506 G186D probably damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dok3 A G 13: 55,524,373 I164T probably benign Het
Ercc5 T A 1: 44,167,881 D651E probably damaging Het
Erp27 T C 6: 136,908,068 K244R probably benign Het
Fam160a1 G A 3: 85,673,252 Q549* probably null Het
Flvcr2 T C 12: 85,747,180 V110A possibly damaging Het
Gm3376 T A Y: 3,774,888 F28L probably damaging Het
Gsta3 T C 1: 21,249,836 L22P probably damaging Het
Hdac5 T C 11: 102,202,696 T493A probably benign Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Hmox1 A G 8: 75,096,916 N71D probably benign Het
Hnrnpr G T 4: 136,336,304 V342F probably damaging Het
Ifi44 T C 3: 151,732,471 D393G probably damaging Het
Ighv1-82 A T 12: 115,952,946 F9I probably damaging Het
Kalrn A G 16: 34,034,494 S1999P probably damaging Het
Kcnq2 A G 2: 181,134,960 S45P probably benign Het
Krt77 A T 15: 101,861,344 Y364N probably damaging Het
Kti12 T C 4: 108,848,279 V130A probably benign Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lrrn1 T A 6: 107,568,544 H434Q probably benign Het
Med13 A T 11: 86,288,975 N1382K probably benign Het
Mrpl42 A G 10: 95,496,822 probably null Het
Mtor A G 4: 148,484,646 D1140G probably benign Het
Mtrr A G 13: 68,572,636 I280T probably benign Het
Myh4 A T 11: 67,248,464 I536F probably damaging Het
Myh4 T A 11: 67,250,303 N730K probably damaging Het
Nat10 A C 2: 103,733,019 L545R probably damaging Het
Nav3 T A 10: 109,684,154 D2356V probably damaging Het
Nlrp1a T C 11: 71,107,662 T904A probably benign Het
Nod2 A T 8: 88,670,422 N820I probably damaging Het
Nptx1 A G 11: 119,542,555 V406A probably damaging Het
Nrd1 T A 4: 109,044,666 I644K probably benign Het
Olfr1508 T C 14: 52,463,416 I198V probably benign Het
Ostf1 T A 19: 18,596,371 I38F probably benign Het
Pde4b G T 4: 102,604,986 D605Y probably damaging Het
Pde4d A G 13: 109,260,662 T3A Het
Pknox1 A G 17: 31,603,209 I317V probably damaging Het
Plekhh2 A G 17: 84,610,812 N1283S probably benign Het
Ppp3cb G A 14: 20,523,800 A289V probably damaging Het
Prag1 A G 8: 36,140,054 D983G probably damaging Het
Psmd13 C T 7: 140,898,542 T62M Het
Rab42 C T 4: 132,302,579 V111I Het
Rabl2 T A 15: 89,590,428 probably null Het
Rapgef6 T A 11: 54,691,343 S1365R probably damaging Het
Rassf4 G T 6: 116,640,304 H247N possibly damaging Het
Rbfox1 A G 16: 7,409,709 T363A probably benign Het
Sbf1 T C 15: 89,300,539 D1091G probably damaging Het
Scaper A G 9: 55,685,991 V454A probably benign Het
Selenbp2 G A 3: 94,700,045 D258N probably benign Het
Sirpa A T 2: 129,615,635 I210F probably damaging Het
Skint4 T C 4: 112,158,039 S434P probably benign Het
Slc26a5 G A 5: 21,811,339 Q682* probably null Het
Slco4a1 C T 2: 180,474,150 S693F possibly damaging Het
Smpd3 A G 8: 106,265,487 F145L probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spata31d1c A T 13: 65,036,226 L527F probably damaging Het
Srd5a3 A G 5: 76,149,947 N199D probably benign Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Sytl1 A G 4: 133,258,980 probably null Het
Tas2r126 A G 6: 42,435,373 H280R probably null Het
Tcf4 C T 18: 69,519,873 probably benign Het
Tlcd2 A G 11: 75,468,286 T28A probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem119 A G 5: 113,795,206 L178P probably damaging Het
Tmem206 G A 1: 191,349,807 R337Q probably damaging Het
Tmprss7 T C 16: 45,664,201 D532G probably benign Het
Tnfaip8l3 A G 9: 54,027,493 I66T probably benign Het
Tor1b A G 2: 30,953,173 Y50C probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Tpra1 T C 6: 88,910,239 V193A probably benign Het
Trip12 A T 1: 84,757,494 V932E probably damaging Het
Ttn T A 2: 76,946,760 T1479S unknown Het
Unc13c A T 9: 73,484,938 V2044D probably damaging Het
Usp25 T G 16: 77,055,188 V197G probably damaging Het
Vmn2r34 A G 7: 7,672,367 V674A probably benign Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Zfp821 A G 8: 109,721,224 T66A probably damaging Het
Zfp97 T A 17: 17,145,668 N476K possibly damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
scotland UTSW 3 55626908 missense probably damaging 1.00
Wales UTSW 3 56091119 missense probably damaging 1.00
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1872:Nbea UTSW 3 55642889 missense probably benign 0.12
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2097:Nbea UTSW 3 55723217 missense probably damaging 0.96
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4758:Nbea UTSW 3 56005403 missense probably benign
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6488:Nbea UTSW 3 55717843 missense probably damaging 0.99
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7935:Nbea UTSW 3 56058665 missense probably damaging 1.00
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
R8290:Nbea UTSW 3 56058635 nonsense probably null
R8314:Nbea UTSW 3 56009251 missense probably damaging 0.99
R8321:Nbea UTSW 3 56183097 missense possibly damaging 0.86
R8376:Nbea UTSW 3 55643655 missense possibly damaging 0.79
R8410:Nbea UTSW 3 56037263 missense probably damaging 1.00
R8556:Nbea UTSW 3 55647386 missense probably benign 0.25
R8753:Nbea UTSW 3 55626908 missense probably damaging 1.00
R8844:Nbea UTSW 3 56090994 missense probably damaging 0.97
R8884:Nbea UTSW 3 55805299 missense probably benign 0.00
R8886:Nbea UTSW 3 56058727 missense probably damaging 1.00
R8890:Nbea UTSW 3 56019363 splice site probably benign
R9004:Nbea UTSW 3 56002938 missense probably benign 0.01
R9022:Nbea UTSW 3 55643689 missense possibly damaging 0.79
R9080:Nbea UTSW 3 56005095 nonsense probably null
R9087:Nbea UTSW 3 55642736 critical splice donor site probably null
R9104:Nbea UTSW 3 55955388 missense probably benign
R9165:Nbea UTSW 3 56004868 missense probably benign 0.15
R9219:Nbea UTSW 3 56090972 frame shift probably null
R9221:Nbea UTSW 3 56090972 frame shift probably null
R9222:Nbea UTSW 3 56090972 frame shift probably null
R9260:Nbea UTSW 3 55983812 missense possibly damaging 0.50
R9263:Nbea UTSW 3 56090972 frame shift probably null
R9265:Nbea UTSW 3 56090972 frame shift probably null
R9294:Nbea UTSW 3 56091092 missense probably benign 0.00
R9360:Nbea UTSW 3 56035898 missense possibly damaging 0.96
R9387:Nbea UTSW 3 55991039 missense probably benign 0.12
R9428:Nbea UTSW 3 56090972 frame shift probably null
R9435:Nbea UTSW 3 56035888 missense possibly damaging 0.63
R9507:Nbea UTSW 3 55665590 missense probably damaging 1.00
R9514:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9674:Nbea UTSW 3 56058762 missense not run
R9688:Nbea UTSW 3 55649744 missense not run
R9709:Nbea UTSW 3 55786458 nonsense probably null
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTGTTTCCTGGAGAAC -3'
(R):5'- GTTCAAGTGTAAAGTGTCCTAAGAG -3'

Sequencing Primer
(F):5'- CAAAAGGTATCTACACTAGACTGAAG -3'
(R):5'- TCCTAAGAGAAGTGGGGATACGGTC -3'
Posted On 2022-07-18