Incidental Mutation 'R9516:Tas2r126'
ID 718557
Institutional Source Beutler Lab
Gene Symbol Tas2r126
Ensembl Gene ENSMUSG00000048284
Gene Name taste receptor, type 2, member 126
Synonyms T2R12, mt2r35, T2R26, mGR26, Tas2r26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42434535-42435464 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42435373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 280 (H280R)
Ref Sequence ENSEMBL: ENSMUSP00000056581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059534]
AlphaFold P59532
Predicted Effect probably null
Transcript: ENSMUST00000059534
AA Change: H280R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056581
Gene: ENSMUSG00000048284
AA Change: H280R

DomainStartEndE-ValueType
Pfam:TAS2R 1 303 2.5e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik T C 2: 150,311,202 N88D possibly damaging Het
4933430I17Rik A G 4: 62,542,679 I264V probably benign Het
Abcc8 A G 7: 46,138,005 F591L probably benign Het
Abr G T 11: 76,419,832 T810K probably damaging Het
Abracl T C 10: 18,018,883 E6G unknown Het
Adamts3 A T 5: 89,686,891 Y871N probably damaging Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Alas1 A G 9: 106,238,641 probably null Het
Anapc1 A C 2: 128,675,713 L337R possibly damaging Het
Apaf1 T C 10: 91,079,954 Y24C probably damaging Het
Arhgef16 A G 4: 154,280,975 V561A possibly damaging Het
Atp10b T A 11: 43,230,397 H962Q probably benign Het
BC067074 A T 13: 113,319,115 N565I Het
Brsk2 A G 7: 141,993,115 T432A probably benign Het
C1rl T A 6: 124,508,843 V391E probably damaging Het
Caps2 A T 10: 112,200,732 H399L probably benign Het
Ccdc43 C A 11: 102,686,381 K199N probably benign Het
Ccdc7a G T 8: 128,829,293 P1198T unknown Het
Cct7 A G 6: 85,467,643 Y423C possibly damaging Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep250 A G 2: 155,991,539 T1795A probably benign Het
Clasp1 T G 1: 118,503,830 S397A possibly damaging Het
Clock A C 5: 76,229,380 F691V possibly damaging Het
Cmklr1 A G 5: 113,614,280 V220A probably benign Het
Coro2b A T 9: 62,428,009 Y298* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dlk2 G A 17: 46,302,506 G186D probably damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dok3 A G 13: 55,524,373 I164T probably benign Het
Ercc5 T A 1: 44,167,881 D651E probably damaging Het
Erp27 T C 6: 136,908,068 K244R probably benign Het
Fam160a1 G A 3: 85,673,252 Q549* probably null Het
Flvcr2 T C 12: 85,747,180 V110A possibly damaging Het
Gm3376 T A Y: 3,774,888 F28L probably damaging Het
Gsta3 T C 1: 21,249,836 L22P probably damaging Het
Hdac5 T C 11: 102,202,696 T493A probably benign Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Hmox1 A G 8: 75,096,916 N71D probably benign Het
Hnrnpr G T 4: 136,336,304 V342F probably damaging Het
Ifi44 T C 3: 151,732,471 D393G probably damaging Het
Ighv1-82 A T 12: 115,952,946 F9I probably damaging Het
Kalrn A G 16: 34,034,494 S1999P probably damaging Het
Kcnq2 A G 2: 181,134,960 S45P probably benign Het
Krt77 A T 15: 101,861,344 Y364N probably damaging Het
Kti12 T C 4: 108,848,279 V130A probably benign Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lrrn1 T A 6: 107,568,544 H434Q probably benign Het
Med13 A T 11: 86,288,975 N1382K probably benign Het
Mrpl42 A G 10: 95,496,822 probably null Het
Mtor A G 4: 148,484,646 D1140G probably benign Het
Mtrr A G 13: 68,572,636 I280T probably benign Het
Myh4 A T 11: 67,248,464 I536F probably damaging Het
Myh4 T A 11: 67,250,303 N730K probably damaging Het
Nat10 A C 2: 103,733,019 L545R probably damaging Het
Nav3 T A 10: 109,684,154 D2356V probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Nlrp1a T C 11: 71,107,662 T904A probably benign Het
Nod2 A T 8: 88,670,422 N820I probably damaging Het
Nptx1 A G 11: 119,542,555 V406A probably damaging Het
Nrd1 T A 4: 109,044,666 I644K probably benign Het
Olfr1508 T C 14: 52,463,416 I198V probably benign Het
Ostf1 T A 19: 18,596,371 I38F probably benign Het
Pde4b G T 4: 102,604,986 D605Y probably damaging Het
Pde4d A G 13: 109,260,662 T3A Het
Pknox1 A G 17: 31,603,209 I317V probably damaging Het
Plekhh2 A G 17: 84,610,812 N1283S probably benign Het
Ppp3cb G A 14: 20,523,800 A289V probably damaging Het
Prag1 A G 8: 36,140,054 D983G probably damaging Het
Psmd13 C T 7: 140,898,542 T62M Het
Rab42 C T 4: 132,302,579 V111I Het
Rabl2 T A 15: 89,590,428 probably null Het
Rapgef6 T A 11: 54,691,343 S1365R probably damaging Het
Rassf4 G T 6: 116,640,304 H247N possibly damaging Het
Rbfox1 A G 16: 7,409,709 T363A probably benign Het
Sbf1 T C 15: 89,300,539 D1091G probably damaging Het
Scaper A G 9: 55,685,991 V454A probably benign Het
Selenbp2 G A 3: 94,700,045 D258N probably benign Het
Sirpa A T 2: 129,615,635 I210F probably damaging Het
Skint4 T C 4: 112,158,039 S434P probably benign Het
Slc26a5 G A 5: 21,811,339 Q682* probably null Het
Slco4a1 C T 2: 180,474,150 S693F possibly damaging Het
Smpd3 A G 8: 106,265,487 F145L probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spata31d1c A T 13: 65,036,226 L527F probably damaging Het
Srd5a3 A G 5: 76,149,947 N199D probably benign Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Sytl1 A G 4: 133,258,980 probably null Het
Tcf4 C T 18: 69,519,873 probably benign Het
Tlcd2 A G 11: 75,468,286 T28A probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem119 A G 5: 113,795,206 L178P probably damaging Het
Tmem206 G A 1: 191,349,807 R337Q probably damaging Het
Tmprss7 T C 16: 45,664,201 D532G probably benign Het
Tnfaip8l3 A G 9: 54,027,493 I66T probably benign Het
Tor1b A G 2: 30,953,173 Y50C probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Tpra1 T C 6: 88,910,239 V193A probably benign Het
Trip12 A T 1: 84,757,494 V932E probably damaging Het
Ttn T A 2: 76,946,760 T1479S unknown Het
Unc13c A T 9: 73,484,938 V2044D probably damaging Het
Usp25 T G 16: 77,055,188 V197G probably damaging Het
Vmn2r34 A G 7: 7,672,367 V674A probably benign Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Zfp821 A G 8: 109,721,224 T66A probably damaging Het
Zfp97 T A 17: 17,145,668 N476K possibly damaging Het
Other mutations in Tas2r126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Tas2r126 APN 6 42435349 missense possibly damaging 0.67
IGL01327:Tas2r126 APN 6 42434750 missense probably benign 0.09
IGL01690:Tas2r126 APN 6 42435307 missense probably benign 0.02
IGL02153:Tas2r126 APN 6 42434664 missense probably benign 0.32
IGL02291:Tas2r126 APN 6 42435287 missense probably benign 0.00
IGL03365:Tas2r126 APN 6 42435457 missense probably benign 0.36
R0091:Tas2r126 UTSW 6 42435102 missense probably benign
R0486:Tas2r126 UTSW 6 42435291 missense probably benign 0.01
R0611:Tas2r126 UTSW 6 42435091 missense probably damaging 0.99
R1527:Tas2r126 UTSW 6 42435136 missense probably benign 0.03
R1529:Tas2r126 UTSW 6 42434568 missense probably benign 0.00
R1883:Tas2r126 UTSW 6 42435027 missense probably benign
R1884:Tas2r126 UTSW 6 42435027 missense probably benign
R2039:Tas2r126 UTSW 6 42434623 missense probably benign 0.22
R4863:Tas2r126 UTSW 6 42435390 missense probably benign 0.02
R5975:Tas2r126 UTSW 6 42435000 missense possibly damaging 0.69
R7127:Tas2r126 UTSW 6 42434805 missense probably damaging 1.00
R7351:Tas2r126 UTSW 6 42435306 missense probably benign 0.02
R7714:Tas2r126 UTSW 6 42435097 missense probably benign 0.12
R9154:Tas2r126 UTSW 6 42435240 missense probably benign 0.25
R9336:Tas2r126 UTSW 6 42434943 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GTTCTCTCAGAAGGCATTCGC -3'
(R):5'- AAAGACATTTCCACGTAGATGAGC -3'

Sequencing Primer
(F):5'- TTCGCTAAGAATGCAGCACAATAC -3'
(R):5'- CGTAGATGAGCTCACTTCCAAG -3'
Posted On 2022-07-18