Incidental Mutation 'R9516:Lrrn1'
ID 718561
Institutional Source Beutler Lab
Gene Symbol Lrrn1
Ensembl Gene ENSMUSG00000034648
Gene Name leucine rich repeat protein 1, neuronal
Synonyms 2810047E21Rik, NLRR-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock # R9516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 107529768-107570214 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107568544 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 434 (H434Q)
Ref Sequence ENSEMBL: ENSMUSP00000037096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049285]
AlphaFold Q61809
Predicted Effect probably benign
Transcript: ENSMUST00000049285
AA Change: H434Q

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037096
Gene: ENSMUSG00000034648
AA Change: H434Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 31 76 2.89e-1 SMART
LRR 94 117 1.06e1 SMART
LRR 118 141 1.89e-1 SMART
LRR_TYP 142 165 4.3e-5 SMART
LRR 166 189 1.76e-1 SMART
LRR 214 237 4.09e1 SMART
LRR 238 261 1.53e1 SMART
LRR 262 285 2.63e0 SMART
LRR 311 335 1.45e2 SMART
LRR 336 359 4.21e1 SMART
LRRCT 371 423 2.14e-10 SMART
IGc2 438 506 6.34e-15 SMART
FN3 523 605 8.71e-2 SMART
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 690 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited decreased exploratory activity and the female mutants exhibited an increased anxiety-like response during open field testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik T C 2: 150,311,202 N88D possibly damaging Het
4933430I17Rik A G 4: 62,542,679 I264V probably benign Het
Abcc8 A G 7: 46,138,005 F591L probably benign Het
Abr G T 11: 76,419,832 T810K probably damaging Het
Abracl T C 10: 18,018,883 E6G unknown Het
Adamts3 A T 5: 89,686,891 Y871N probably damaging Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Alas1 A G 9: 106,238,641 probably null Het
Anapc1 A C 2: 128,675,713 L337R possibly damaging Het
Apaf1 T C 10: 91,079,954 Y24C probably damaging Het
Arhgef16 A G 4: 154,280,975 V561A possibly damaging Het
Atp10b T A 11: 43,230,397 H962Q probably benign Het
BC067074 A T 13: 113,319,115 N565I Het
Brsk2 A G 7: 141,993,115 T432A probably benign Het
C1rl T A 6: 124,508,843 V391E probably damaging Het
Caps2 A T 10: 112,200,732 H399L probably benign Het
Ccdc43 C A 11: 102,686,381 K199N probably benign Het
Ccdc7a G T 8: 128,829,293 P1198T unknown Het
Cct7 A G 6: 85,467,643 Y423C possibly damaging Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep250 A G 2: 155,991,539 T1795A probably benign Het
Clasp1 T G 1: 118,503,830 S397A possibly damaging Het
Clock A C 5: 76,229,380 F691V possibly damaging Het
Cmklr1 A G 5: 113,614,280 V220A probably benign Het
Coro2b A T 9: 62,428,009 Y298* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dlk2 G A 17: 46,302,506 G186D probably damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dok3 A G 13: 55,524,373 I164T probably benign Het
Ercc5 T A 1: 44,167,881 D651E probably damaging Het
Erp27 T C 6: 136,908,068 K244R probably benign Het
Fam160a1 G A 3: 85,673,252 Q549* probably null Het
Flvcr2 T C 12: 85,747,180 V110A possibly damaging Het
Gm3376 T A Y: 3,774,888 F28L probably damaging Het
Gsta3 T C 1: 21,249,836 L22P probably damaging Het
Hdac5 T C 11: 102,202,696 T493A probably benign Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Hmox1 A G 8: 75,096,916 N71D probably benign Het
Hnrnpr G T 4: 136,336,304 V342F probably damaging Het
Ifi44 T C 3: 151,732,471 D393G probably damaging Het
Ighv1-82 A T 12: 115,952,946 F9I probably damaging Het
Kalrn A G 16: 34,034,494 S1999P probably damaging Het
Kcnq2 A G 2: 181,134,960 S45P probably benign Het
Krt77 A T 15: 101,861,344 Y364N probably damaging Het
Kti12 T C 4: 108,848,279 V130A probably benign Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Med13 A T 11: 86,288,975 N1382K probably benign Het
Mrpl42 A G 10: 95,496,822 probably null Het
Mtor A G 4: 148,484,646 D1140G probably benign Het
Mtrr A G 13: 68,572,636 I280T probably benign Het
Myh4 A T 11: 67,248,464 I536F probably damaging Het
Myh4 T A 11: 67,250,303 N730K probably damaging Het
Nat10 A C 2: 103,733,019 L545R probably damaging Het
Nav3 T A 10: 109,684,154 D2356V probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Nlrp1a T C 11: 71,107,662 T904A probably benign Het
Nod2 A T 8: 88,670,422 N820I probably damaging Het
Nptx1 A G 11: 119,542,555 V406A probably damaging Het
Nrd1 T A 4: 109,044,666 I644K probably benign Het
Olfr1508 T C 14: 52,463,416 I198V probably benign Het
Ostf1 T A 19: 18,596,371 I38F probably benign Het
Pde4b G T 4: 102,604,986 D605Y probably damaging Het
Pde4d A G 13: 109,260,662 T3A Het
Pknox1 A G 17: 31,603,209 I317V probably damaging Het
Plekhh2 A G 17: 84,610,812 N1283S probably benign Het
Ppp3cb G A 14: 20,523,800 A289V probably damaging Het
Prag1 A G 8: 36,140,054 D983G probably damaging Het
Psmd13 C T 7: 140,898,542 T62M Het
Rab42 C T 4: 132,302,579 V111I Het
Rabl2 T A 15: 89,590,428 probably null Het
Rapgef6 T A 11: 54,691,343 S1365R probably damaging Het
Rassf4 G T 6: 116,640,304 H247N possibly damaging Het
Rbfox1 A G 16: 7,409,709 T363A probably benign Het
Sbf1 T C 15: 89,300,539 D1091G probably damaging Het
Scaper A G 9: 55,685,991 V454A probably benign Het
Selenbp2 G A 3: 94,700,045 D258N probably benign Het
Sirpa A T 2: 129,615,635 I210F probably damaging Het
Skint4 T C 4: 112,158,039 S434P probably benign Het
Slc26a5 G A 5: 21,811,339 Q682* probably null Het
Slco4a1 C T 2: 180,474,150 S693F possibly damaging Het
Smpd3 A G 8: 106,265,487 F145L probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spata31d1c A T 13: 65,036,226 L527F probably damaging Het
Srd5a3 A G 5: 76,149,947 N199D probably benign Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Sytl1 A G 4: 133,258,980 probably null Het
Tas2r126 A G 6: 42,435,373 H280R probably null Het
Tcf4 C T 18: 69,519,873 probably benign Het
Tlcd2 A G 11: 75,468,286 T28A probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem119 A G 5: 113,795,206 L178P probably damaging Het
Tmem206 G A 1: 191,349,807 R337Q probably damaging Het
Tmprss7 T C 16: 45,664,201 D532G probably benign Het
Tnfaip8l3 A G 9: 54,027,493 I66T probably benign Het
Tor1b A G 2: 30,953,173 Y50C probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Tpra1 T C 6: 88,910,239 V193A probably benign Het
Trip12 A T 1: 84,757,494 V932E probably damaging Het
Ttn T A 2: 76,946,760 T1479S unknown Het
Unc13c A T 9: 73,484,938 V2044D probably damaging Het
Usp25 T G 16: 77,055,188 V197G probably damaging Het
Vmn2r34 A G 7: 7,672,367 V674A probably benign Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Zfp821 A G 8: 109,721,224 T66A probably damaging Het
Zfp97 T A 17: 17,145,668 N476K possibly damaging Het
Other mutations in Lrrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrrn1 APN 6 107568308 missense probably benign 0.06
IGL00949:Lrrn1 APN 6 107569300 missense probably benign 0.15
IGL01594:Lrrn1 APN 6 107567493 missense probably damaging 0.99
IGL02814:Lrrn1 APN 6 107567352 missense probably damaging 1.00
IGL02824:Lrrn1 APN 6 107568534 missense possibly damaging 0.57
IGL02931:Lrrn1 APN 6 107567748 missense probably damaging 1.00
R0399:Lrrn1 UTSW 6 107569120 missense probably benign
R1109:Lrrn1 UTSW 6 107567264 missense probably benign
R1620:Lrrn1 UTSW 6 107568366 missense probably damaging 1.00
R1826:Lrrn1 UTSW 6 107567568 missense probably benign 0.05
R1893:Lrrn1 UTSW 6 107568122 missense possibly damaging 0.82
R2327:Lrrn1 UTSW 6 107568833 missense probably benign 0.05
R3684:Lrrn1 UTSW 6 107567949 missense probably benign 0.13
R3757:Lrrn1 UTSW 6 107569208 missense possibly damaging 0.81
R4538:Lrrn1 UTSW 6 107568637 missense probably benign 0.21
R4922:Lrrn1 UTSW 6 107568350 missense probably damaging 1.00
R4946:Lrrn1 UTSW 6 107568890 missense probably benign 0.16
R4970:Lrrn1 UTSW 6 107569344 missense probably benign 0.06
R4977:Lrrn1 UTSW 6 107568707 missense probably benign
R5121:Lrrn1 UTSW 6 107569207 missense possibly damaging 0.89
R5186:Lrrn1 UTSW 6 107569224 missense probably damaging 1.00
R5625:Lrrn1 UTSW 6 107567354 missense probably damaging 0.99
R5736:Lrrn1 UTSW 6 107567384 missense probably damaging 1.00
R5873:Lrrn1 UTSW 6 107568975 missense probably damaging 0.98
R5949:Lrrn1 UTSW 6 107567504 missense probably benign 0.00
R6046:Lrrn1 UTSW 6 107568527 missense probably benign 0.00
R6370:Lrrn1 UTSW 6 107569224 missense probably damaging 1.00
R7138:Lrrn1 UTSW 6 107568375 missense probably damaging 1.00
R7169:Lrrn1 UTSW 6 107567604 missense probably damaging 1.00
R7413:Lrrn1 UTSW 6 107569122 missense probably benign 0.00
R7449:Lrrn1 UTSW 6 107568521 missense possibly damaging 0.91
R7969:Lrrn1 UTSW 6 107567850 missense probably damaging 1.00
R8077:Lrrn1 UTSW 6 107568822 missense probably damaging 0.99
R8288:Lrrn1 UTSW 6 107566994 start gained probably benign
R8420:Lrrn1 UTSW 6 107569333 missense probably benign 0.00
R8725:Lrrn1 UTSW 6 107567342 nonsense probably null
R9007:Lrrn1 UTSW 6 107567859 missense probably damaging 0.99
R9133:Lrrn1 UTSW 6 107567607 missense probably damaging 1.00
R9367:Lrrn1 UTSW 6 107568132 missense probably damaging 0.98
R9373:Lrrn1 UTSW 6 107568504 missense possibly damaging 0.82
R9475:Lrrn1 UTSW 6 107568300 missense probably damaging 1.00
R9513:Lrrn1 UTSW 6 107568544 missense probably benign 0.04
R9549:Lrrn1 UTSW 6 107569017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTGTGACTGTGTCATCC -3'
(R):5'- TCCTTGGACATTCTGGGCAAC -3'

Sequencing Primer
(F):5'- GACTGTGTCATCCACTGGATCAAC -3'
(R):5'- AACGCAGGTGTACCTTCCTGAG -3'
Posted On 2022-07-18