Incidental Mutation 'R9516:Rapgef6'
ID 718591
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54691343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1365 (S1365R)
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101206
AA Change: S1368R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: S1368R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102743
AA Change: S1360R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: S1360R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136494
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207429
AA Change: S1365R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik T C 2: 150,311,202 N88D possibly damaging Het
4933430I17Rik A G 4: 62,542,679 I264V probably benign Het
Abcc8 A G 7: 46,138,005 F591L probably benign Het
Abr G T 11: 76,419,832 T810K probably damaging Het
Abracl T C 10: 18,018,883 E6G unknown Het
Adamts3 A T 5: 89,686,891 Y871N probably damaging Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Alas1 A G 9: 106,238,641 probably null Het
Anapc1 A C 2: 128,675,713 L337R possibly damaging Het
Apaf1 T C 10: 91,079,954 Y24C probably damaging Het
Arhgef16 A G 4: 154,280,975 V561A possibly damaging Het
Atp10b T A 11: 43,230,397 H962Q probably benign Het
BC067074 A T 13: 113,319,115 N565I Het
Brsk2 A G 7: 141,993,115 T432A probably benign Het
C1rl T A 6: 124,508,843 V391E probably damaging Het
Caps2 A T 10: 112,200,732 H399L probably benign Het
Ccdc43 C A 11: 102,686,381 K199N probably benign Het
Ccdc7a G T 8: 128,829,293 P1198T unknown Het
Cct7 A G 6: 85,467,643 Y423C possibly damaging Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep250 A G 2: 155,991,539 T1795A probably benign Het
Clasp1 T G 1: 118,503,830 S397A possibly damaging Het
Clock A C 5: 76,229,380 F691V possibly damaging Het
Cmklr1 A G 5: 113,614,280 V220A probably benign Het
Coro2b A T 9: 62,428,009 Y298* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dlk2 G A 17: 46,302,506 G186D probably damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Dok3 A G 13: 55,524,373 I164T probably benign Het
Ercc5 T A 1: 44,167,881 D651E probably damaging Het
Erp27 T C 6: 136,908,068 K244R probably benign Het
Fam160a1 G A 3: 85,673,252 Q549* probably null Het
Flvcr2 T C 12: 85,747,180 V110A possibly damaging Het
Gm3376 T A Y: 3,774,888 F28L probably damaging Het
Gsta3 T C 1: 21,249,836 L22P probably damaging Het
Hdac5 T C 11: 102,202,696 T493A probably benign Het
Hivep2 T A 10: 14,129,779 I707N probably benign Het
Hmox1 A G 8: 75,096,916 N71D probably benign Het
Hnrnpr G T 4: 136,336,304 V342F probably damaging Het
Ifi44 T C 3: 151,732,471 D393G probably damaging Het
Ighv1-82 A T 12: 115,952,946 F9I probably damaging Het
Kalrn A G 16: 34,034,494 S1999P probably damaging Het
Kcnq2 A G 2: 181,134,960 S45P probably benign Het
Krt77 A T 15: 101,861,344 Y364N probably damaging Het
Kti12 T C 4: 108,848,279 V130A probably benign Het
Lama2 T C 10: 27,224,019 E830G probably benign Het
Lrrn1 T A 6: 107,568,544 H434Q probably benign Het
Med13 A T 11: 86,288,975 N1382K probably benign Het
Mrpl42 A G 10: 95,496,822 probably null Het
Mtor A G 4: 148,484,646 D1140G probably benign Het
Mtrr A G 13: 68,572,636 I280T probably benign Het
Myh4 A T 11: 67,248,464 I536F probably damaging Het
Myh4 T A 11: 67,250,303 N730K probably damaging Het
Nat10 A C 2: 103,733,019 L545R probably damaging Het
Nav3 T A 10: 109,684,154 D2356V probably damaging Het
Nbea A T 3: 56,029,945 S748R probably damaging Het
Nlrp1a T C 11: 71,107,662 T904A probably benign Het
Nod2 A T 8: 88,670,422 N820I probably damaging Het
Nptx1 A G 11: 119,542,555 V406A probably damaging Het
Nrd1 T A 4: 109,044,666 I644K probably benign Het
Olfr1508 T C 14: 52,463,416 I198V probably benign Het
Ostf1 T A 19: 18,596,371 I38F probably benign Het
Pde4b G T 4: 102,604,986 D605Y probably damaging Het
Pde4d A G 13: 109,260,662 T3A Het
Pknox1 A G 17: 31,603,209 I317V probably damaging Het
Plekhh2 A G 17: 84,610,812 N1283S probably benign Het
Ppp3cb G A 14: 20,523,800 A289V probably damaging Het
Prag1 A G 8: 36,140,054 D983G probably damaging Het
Psmd13 C T 7: 140,898,542 T62M Het
Rab42 C T 4: 132,302,579 V111I Het
Rabl2 T A 15: 89,590,428 probably null Het
Rassf4 G T 6: 116,640,304 H247N possibly damaging Het
Rbfox1 A G 16: 7,409,709 T363A probably benign Het
Sbf1 T C 15: 89,300,539 D1091G probably damaging Het
Scaper A G 9: 55,685,991 V454A probably benign Het
Selenbp2 G A 3: 94,700,045 D258N probably benign Het
Sirpa A T 2: 129,615,635 I210F probably damaging Het
Skint4 T C 4: 112,158,039 S434P probably benign Het
Slc26a5 G A 5: 21,811,339 Q682* probably null Het
Slco4a1 C T 2: 180,474,150 S693F possibly damaging Het
Smpd3 A G 8: 106,265,487 F145L probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spata31d1c A T 13: 65,036,226 L527F probably damaging Het
Srd5a3 A G 5: 76,149,947 N199D probably benign Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Sytl1 A G 4: 133,258,980 probably null Het
Tas2r126 A G 6: 42,435,373 H280R probably null Het
Tcf4 C T 18: 69,519,873 probably benign Het
Tlcd2 A G 11: 75,468,286 T28A probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem119 A G 5: 113,795,206 L178P probably damaging Het
Tmem206 G A 1: 191,349,807 R337Q probably damaging Het
Tmprss7 T C 16: 45,664,201 D532G probably benign Het
Tnfaip8l3 A G 9: 54,027,493 I66T probably benign Het
Tor1b A G 2: 30,953,173 Y50C probably damaging Het
Tpp2 T A 1: 43,978,488 S751T probably benign Het
Tpra1 T C 6: 88,910,239 V193A probably benign Het
Trip12 A T 1: 84,757,494 V932E probably damaging Het
Ttn T A 2: 76,946,760 T1479S unknown Het
Unc13c A T 9: 73,484,938 V2044D probably damaging Het
Usp25 T G 16: 77,055,188 V197G probably damaging Het
Vmn2r34 A G 7: 7,672,367 V674A probably benign Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Zfp821 A G 8: 109,721,224 T66A probably damaging Het
Zfp97 T A 17: 17,145,668 N476K possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9739:Rapgef6 UTSW 11 54622363 missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54649271 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCTTAGAGGAAACATTGCCTAGC -3'
(R):5'- TCTTGAGCAGCCTTTAGGAC -3'

Sequencing Primer
(F):5'- CTAGCTAAGGATTCAGGTGTGTCC -3'
(R):5'- CAGCCTTTAGGACAGGCACAG -3'
Posted On 2022-07-18