Incidental Mutation 'R9516:Rapgef6'
ID 718591
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54582169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1365 (S1365R)
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101206
AA Change: S1368R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: S1368R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102743
AA Change: S1360R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: S1360R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136494
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207429
AA Change: S1365R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik T C 2: 150,153,122 (GRCm39) N88D possibly damaging Het
4933430I17Rik A G 4: 62,460,916 (GRCm39) I264V probably benign Het
Abcc8 A G 7: 45,787,429 (GRCm39) F591L probably benign Het
Abr G T 11: 76,310,658 (GRCm39) T810K probably damaging Het
Abracl T C 10: 17,894,631 (GRCm39) E6G unknown Het
Adamts3 A T 5: 89,834,750 (GRCm39) Y871N probably damaging Het
Akap13 T C 7: 75,354,275 (GRCm39) Y80H probably benign Het
Alas1 A G 9: 106,115,840 (GRCm39) probably null Het
Anapc1 A C 2: 128,517,633 (GRCm39) L337R possibly damaging Het
Apaf1 T C 10: 90,915,816 (GRCm39) Y24C probably damaging Het
Arhgef16 A G 4: 154,365,432 (GRCm39) V561A possibly damaging Het
Atp10b T A 11: 43,121,224 (GRCm39) H962Q probably benign Het
Brsk2 A G 7: 141,546,852 (GRCm39) T432A probably benign Het
C1rl T A 6: 124,485,802 (GRCm39) V391E probably damaging Het
Caps2 A T 10: 112,036,637 (GRCm39) H399L probably benign Het
Ccdc43 C A 11: 102,577,207 (GRCm39) K199N probably benign Het
Ccdc7a G T 8: 129,555,774 (GRCm39) P1198T unknown Het
Cct7 A G 6: 85,444,625 (GRCm39) Y423C possibly damaging Het
Cep112 A G 11: 108,648,514 (GRCm39) T783A probably damaging Het
Cep250 A G 2: 155,833,459 (GRCm39) T1795A probably benign Het
Clasp1 T G 1: 118,431,560 (GRCm39) S397A possibly damaging Het
Clock A C 5: 76,377,227 (GRCm39) F691V possibly damaging Het
Cmklr1 A G 5: 113,752,341 (GRCm39) V220A probably benign Het
Coro2b A T 9: 62,335,291 (GRCm39) Y298* probably null Het
Cspg4b A T 13: 113,455,649 (GRCm39) N565I Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dlk2 G A 17: 46,613,432 (GRCm39) G186D probably damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Dok3 A G 13: 55,672,186 (GRCm39) I164T probably benign Het
Ercc5 T A 1: 44,207,041 (GRCm39) D651E probably damaging Het
Erp27 T C 6: 136,885,066 (GRCm39) K244R probably benign Het
Fhip1a G A 3: 85,580,559 (GRCm39) Q549* probably null Het
Flvcr2 T C 12: 85,793,954 (GRCm39) V110A possibly damaging Het
Gsta3 T C 1: 21,320,060 (GRCm39) L22P probably damaging Het
Hdac5 T C 11: 102,093,522 (GRCm39) T493A probably benign Het
Hivep2 T A 10: 14,005,523 (GRCm39) I707N probably benign Het
Hmox1 A G 8: 75,823,544 (GRCm39) N71D probably benign Het
Hnrnpr G T 4: 136,063,615 (GRCm39) V342F probably damaging Het
Ifi44 T C 3: 151,438,108 (GRCm39) D393G probably damaging Het
Ighv1-82 A T 12: 115,916,566 (GRCm39) F9I probably damaging Het
Kalrn A G 16: 33,854,864 (GRCm39) S1999P probably damaging Het
Kcnq2 A G 2: 180,776,753 (GRCm39) S45P probably benign Het
Krt77 A T 15: 101,769,779 (GRCm39) Y364N probably damaging Het
Kti12 T C 4: 108,705,476 (GRCm39) V130A probably benign Het
Lama2 T C 10: 27,100,015 (GRCm39) E830G probably benign Het
Lrrn1 T A 6: 107,545,505 (GRCm39) H434Q probably benign Het
Med13 A T 11: 86,179,801 (GRCm39) N1382K probably benign Het
Mrpl42 A G 10: 95,332,684 (GRCm39) probably null Het
Mtor A G 4: 148,569,103 (GRCm39) D1140G probably benign Het
Mtrr A G 13: 68,720,755 (GRCm39) I280T probably benign Het
Myh4 A T 11: 67,139,290 (GRCm39) I536F probably damaging Het
Myh4 T A 11: 67,141,129 (GRCm39) N730K probably damaging Het
Nat10 A C 2: 103,563,364 (GRCm39) L545R probably damaging Het
Nav3 T A 10: 109,520,015 (GRCm39) D2356V probably damaging Het
Nbea A T 3: 55,937,366 (GRCm39) S748R probably damaging Het
Nlrp1a T C 11: 70,998,488 (GRCm39) T904A probably benign Het
Nod2 A T 8: 89,397,050 (GRCm39) N820I probably damaging Het
Nptx1 A G 11: 119,433,381 (GRCm39) V406A probably damaging Het
Nrdc T A 4: 108,901,863 (GRCm39) I644K probably benign Het
Or4e1 T C 14: 52,700,873 (GRCm39) I198V probably benign Het
Ostf1 T A 19: 18,573,735 (GRCm39) I38F probably benign Het
Pacc1 G A 1: 191,082,004 (GRCm39) R337Q probably damaging Het
Pde4b G T 4: 102,462,183 (GRCm39) D605Y probably damaging Het
Pde4d A G 13: 109,397,196 (GRCm39) T3A Het
Pknox1 A G 17: 31,822,183 (GRCm39) I317V probably damaging Het
Plekhh2 A G 17: 84,918,240 (GRCm39) N1283S probably benign Het
Ppp3cb G A 14: 20,573,868 (GRCm39) A289V probably damaging Het
Prag1 A G 8: 36,607,208 (GRCm39) D983G probably damaging Het
Psmd13 C T 7: 140,478,455 (GRCm39) T62M Het
Rab42 C T 4: 132,029,890 (GRCm39) V111I Het
Rabl2 T A 15: 89,474,631 (GRCm39) probably null Het
Rassf4 G T 6: 116,617,265 (GRCm39) H247N possibly damaging Het
Rbfox1 A G 16: 7,227,573 (GRCm39) T363A probably benign Het
Rbmyf9 T A Y: 3,774,888 (GRCm39) F28L probably damaging Het
Sbf1 T C 15: 89,184,742 (GRCm39) D1091G probably damaging Het
Scaper A G 9: 55,593,275 (GRCm39) V454A probably benign Het
Selenbp2 G A 3: 94,607,352 (GRCm39) D258N probably benign Het
Sirpa A T 2: 129,457,555 (GRCm39) I210F probably damaging Het
Skint4 T C 4: 112,015,236 (GRCm39) S434P probably benign Het
Slc26a5 G A 5: 22,016,337 (GRCm39) Q682* probably null Het
Slco4a1 C T 2: 180,115,943 (GRCm39) S693F possibly damaging Het
Smpd3 A G 8: 106,992,119 (GRCm39) F145L probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Spata31d1c A T 13: 65,184,040 (GRCm39) L527F probably damaging Het
Srd5a3 A G 5: 76,297,794 (GRCm39) N199D probably benign Het
Stard9 C G 2: 120,534,564 (GRCm39) P3607R probably damaging Het
Sytl1 A G 4: 132,986,291 (GRCm39) probably null Het
Tas2r126 A G 6: 42,412,307 (GRCm39) H280R probably null Het
Tcf4 C T 18: 69,652,944 (GRCm39) probably benign Het
Tlcd2 A G 11: 75,359,112 (GRCm39) T28A probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem119 A G 5: 113,933,267 (GRCm39) L178P probably damaging Het
Tmprss7 T C 16: 45,484,564 (GRCm39) D532G probably benign Het
Tnfaip8l3 A G 9: 53,934,777 (GRCm39) I66T probably benign Het
Tor1b A G 2: 30,843,185 (GRCm39) Y50C probably damaging Het
Tpp2 T A 1: 44,017,648 (GRCm39) S751T probably benign Het
Tpra1 T C 6: 88,887,221 (GRCm39) V193A probably benign Het
Trip12 A T 1: 84,735,215 (GRCm39) V932E probably damaging Het
Ttn T A 2: 76,777,104 (GRCm39) T1479S unknown Het
Unc13c A T 9: 73,392,220 (GRCm39) V2044D probably damaging Het
Usp25 T G 16: 76,852,076 (GRCm39) V197G probably damaging Het
Vmn2r34 A G 7: 7,675,366 (GRCm39) V674A probably benign Het
Zfp7 T C 15: 76,775,484 (GRCm39) S509P probably damaging Het
Zfp821 A G 8: 110,447,856 (GRCm39) T66A probably damaging Het
Zfp97 T A 17: 17,365,930 (GRCm39) N476K possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCTTAGAGGAAACATTGCCTAGC -3'
(R):5'- TCTTGAGCAGCCTTTAGGAC -3'

Sequencing Primer
(F):5'- CTAGCTAAGGATTCAGGTGTGTCC -3'
(R):5'- CAGCCTTTAGGACAGGCACAG -3'
Posted On 2022-07-18