Incidental Mutation 'R9517:Dock9'
ID 718676
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121591824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1392 (T1392A)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: T1391A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: T1391A

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: T1392A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: T1382A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,113,529 V264E probably damaging Het
Abca15 A G 7: 120,388,201 I1237V probably benign Het
Actn2 G T 13: 12,280,431 Q552K probably damaging Het
Adnp A T 2: 168,182,946 C810S possibly damaging Het
Aip A T 19: 4,118,217 I50K possibly damaging Het
Arsk A G 13: 76,062,519 S470P probably damaging Het
Aspm T A 1: 139,479,429 I2018K probably damaging Het
Aspn G A 13: 49,551,799 D46N Het
C6 G T 15: 4,798,432 C761F probably damaging Het
Cdk12 A T 11: 98,219,084 T644S unknown Het
Cela3a T A 4: 137,404,514 I123F probably damaging Het
Chchd3 A T 6: 33,049,382 S42T probably benign Het
Chst5 A G 8: 111,890,020 S323P possibly damaging Het
Clec4g C A 8: 3,717,452 A198S probably damaging Het
Dcbld2 T G 16: 58,433,456 D185E probably benign Het
Dnah17 A G 11: 118,024,614 V4393A possibly damaging Het
Ell2 A G 13: 75,763,987 K464R possibly damaging Het
Eme2 G A 17: 24,895,059 probably benign Het
Eps8l1 T A 7: 4,477,637 I530N probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbxw25 A G 9: 109,651,824 Y263H Het
Frem1 T C 4: 82,983,477 Y938C probably damaging Het
Gdf10 A G 14: 33,932,565 D343G probably benign Het
Gm13089 T A 4: 143,698,360 D171V possibly damaging Het
Gm3415 C T 5: 146,556,596 R84C possibly damaging Het
Gm884 G A 11: 103,542,590 T3251I unknown Het
Hap1 A T 11: 100,349,362 V536D possibly damaging Het
Icos T C 1: 60,993,735 F31S probably damaging Het
Inpp5d T A 1: 87,711,131 S812T probably benign Het
Kcng4 A G 8: 119,626,331 V280A probably benign Het
Ldlr T C 9: 21,743,944 V623A possibly damaging Het
Lipc T C 9: 70,802,278 T396A probably benign Het
Lrit2 T A 14: 37,072,315 C445* probably null Het
Mcc C A 18: 44,661,727 G10C probably damaging Het
Mtfr1l T C 4: 134,529,204 T217A probably benign Het
Mtrr A T 13: 68,580,611 S23R probably benign Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo7a A T 7: 98,071,959 D1255E probably damaging Het
Nfatc1 T C 18: 80,682,191 K453E probably damaging Het
Nrap A T 19: 56,371,845 M466K probably benign Het
Olfr1204 G A 2: 88,852,603 V218I probably benign Het
Olfr1278 T G 2: 111,292,688 M140R possibly damaging Het
Olfr218 C A 1: 173,203,779 A141D possibly damaging Het
Olfr742 C A 14: 50,515,313 F36L probably benign Het
Olfr890 T A 9: 38,143,327 M59K probably damaging Het
Osbpl1a A G 18: 12,909,908 V192A probably benign Het
Papd7 A G 13: 69,506,940 C472R probably damaging Het
Pgd T C 4: 149,165,211 T35A possibly damaging Het
Plcxd3 G T 15: 4,375,678 probably benign Het
Prmt7 A G 8: 106,227,298 T124A probably damaging Het
Pzp A G 6: 128,512,154 probably null Het
Rilpl2 A G 5: 124,469,725 V144A probably benign Het
Rin3 T C 12: 102,368,636 S269P unknown Het
Setbp1 T C 18: 78,858,107 S782G probably damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Sox6 A G 7: 115,512,735 L552S possibly damaging Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r11 A G 6: 57,137,570 D73G possibly damaging Het
Vmn1r39 A C 6: 66,805,274 I20R possibly damaging Het
Vmn2r82 C T 10: 79,377,807 R76* probably null Het
Zhx1 A T 15: 58,052,416 Y811* probably null Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTTGGGCACTTTGAGACG -3'
(R):5'- CTTGGTGTAACGCGTCTAACG -3'

Sequencing Primer
(F):5'- GCTGTAGTTGATTTGGCCCCAC -3'
(R):5'- ACGCGTCTAACGTTGCTTC -3'
Posted On 2022-07-18