Incidental Mutation 'R9518:Prdm2'
ID 718696
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene Name PR domain containing 2, with ZNF domain
Synonyms KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9518 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 143107391-143212995 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 143134009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 904 (S904G)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
AlphaFold A2A7B5
Predicted Effect possibly damaging
Transcript: ENSMUST00000105778
AA Change: S904G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S904G

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,754,141 H490Q possibly damaging Het
Abcf2 T C 5: 24,566,562 T556A possibly damaging Het
B230104I21Rik G T 4: 154,349,547 E63* probably null Het
Brpf1 A G 6: 113,309,834 K8E possibly damaging Het
Cacna1i G A 15: 80,387,777 G1582D probably damaging Het
Ccdc162 T A 10: 41,589,576 D1428V probably damaging Het
Ccdc178 G A 18: 22,145,459 T69I possibly damaging Het
Ccdc62 T A 5: 123,951,225 L309I possibly damaging Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Cps1 G T 1: 67,220,503 V1335L probably damaging Het
Desi2 A G 1: 178,187,926 N4S probably benign Het
Dlx6 C A 6: 6,863,406 D9E probably damaging Het
Dnah12 A C 14: 26,773,756 D198A probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dpp8 T C 9: 65,074,584 M716T possibly damaging Het
Dvl3 T A 16: 20,517,211 I6N possibly damaging Het
Egflam A G 15: 7,289,782 probably null Het
Eprs A T 1: 185,379,566 M258L probably benign Het
Etnk1 A T 6: 143,203,418 M352L probably benign Het
Fam124a A C 14: 62,587,498 D147A probably damaging Het
Fstl4 A G 11: 53,165,820 D468G possibly damaging Het
Grm8 T A 6: 27,429,470 Q475L probably benign Het
Kel T C 6: 41,702,400 E143G probably damaging Het
Kif21a A G 15: 90,956,473 Y1147H probably damaging Het
Kndc1 A G 7: 139,939,914 K1729E probably damaging Het
Map4k1 G A 7: 28,994,071 R433H probably benign Het
Mettl14 T C 3: 123,374,038 I224V probably benign Het
Mgat5b A G 11: 116,978,473 N614S probably benign Het
Mlh3 C T 12: 85,266,230 V1061I probably benign Het
Myo1h T C 5: 114,359,527 V27A probably damaging Het
Naip5 A T 13: 100,221,859 H956Q probably benign Het
Olfr1341 A G 4: 118,709,923 N172S probably damaging Het
Olfr746 A T 14: 50,653,644 M136L probably damaging Het
Papd4 A G 13: 93,184,104 I147T probably benign Het
Pcdh7 A T 5: 57,913,171 T1064S possibly damaging Het
Peg3 T C 7: 6,711,281 E314G probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr A T 9: 8,922,644 D605V probably damaging Het
Prpf8 T C 11: 75,503,660 I1807T possibly damaging Het
Serpinb3c T A 1: 107,272,738 Q225L probably damaging Het
Soga3 T A 10: 29,146,752 C32S probably benign Het
Strn3 A C 12: 51,650,173 D258E probably damaging Het
Tgm2 C T 2: 158,143,129 R19H probably benign Het
Themis T A 10: 28,668,752 probably null Het
Trim28 C T 7: 13,030,518 P753S probably damaging Het
Vac14 C T 8: 110,715,438 Q683* probably null Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Zfp541 T C 7: 16,079,111 I563T possibly damaging Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
G1patch:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8688:Prdm2 UTSW 4 143111740 missense probably benign
R8732:Prdm2 UTSW 4 143136010 missense probably benign 0.00
R8796:Prdm2 UTSW 4 143133447 missense probably benign 0.33
R8874:Prdm2 UTSW 4 143133215 missense possibly damaging 0.70
R8887:Prdm2 UTSW 4 143134201 missense probably damaging 1.00
R9119:Prdm2 UTSW 4 143131879 nonsense probably null
R9139:Prdm2 UTSW 4 143132182 missense probably benign 0.03
R9165:Prdm2 UTSW 4 143132104 missense possibly damaging 0.73
R9342:Prdm2 UTSW 4 143134908 missense probably damaging 1.00
R9546:Prdm2 UTSW 4 143134991 missense probably damaging 1.00
R9547:Prdm2 UTSW 4 143134991 missense probably damaging 1.00
R9680:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAAGGCTCTGTGGGGATC -3'
(R):5'- CAGCGGTGTCAAACAGAAGTC -3'

Sequencing Primer
(F):5'- GCTCTGTGGGGATCAAGAG -3'
(R):5'- CCCATGGGAATCTGTATTGGATCTC -3'
Posted On 2022-07-18