Mutagenetix > Incidental Mutation

Incidental Mutation 'R9518:Prpf8'

718722

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R9518 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75503660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1807 (I1807T)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: I1807T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: I1807T

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: I1807T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: I1807T

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,754,141	H490Q	possibly damaging	Het
Abcf2	T	C	5: 24,566,562	T556A	possibly damaging	Het
B230104I21Rik	G	T	4: 154,349,547	E63*	probably null	Het
Brpf1	A	G	6: 113,309,834	K8E	possibly damaging	Het
Cacna1i	G	A	15: 80,387,777	G1582D	probably damaging	Het
Ccdc162	T	A	10: 41,589,576	D1428V	probably damaging	Het
Ccdc178	G	A	18: 22,145,459	T69I	possibly damaging	Het
Ccdc62	T	A	5: 123,951,225	L309I	possibly damaging	Het
Ces5a	T	C	8: 93,530,802	N125S	probably damaging	Het
Cps1	G	T	1: 67,220,503	V1335L	probably damaging	Het
Desi2	A	G	1: 178,187,926	N4S	probably benign	Het
Dlx6	C	A	6: 6,863,406	D9E	probably damaging	Het
Dnah12	A	C	14: 26,773,756	D198A	probably damaging	Het
Dnah8	CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT	CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT	17: 30,760,867		probably null	Het
Dpp8	T	C	9: 65,074,584	M716T	possibly damaging	Het
Dvl3	T	A	16: 20,517,211	I6N	possibly damaging	Het
Egflam	A	G	15: 7,289,782		probably null	Het
Eprs	A	T	1: 185,379,566	M258L	probably benign	Het
Etnk1	A	T	6: 143,203,418	M352L	probably benign	Het
Fam124a	A	C	14: 62,587,498	D147A	probably damaging	Het
Fstl4	A	G	11: 53,165,820	D468G	possibly damaging	Het
Grm8	T	A	6: 27,429,470	Q475L	probably benign	Het
Kel	T	C	6: 41,702,400	E143G	probably damaging	Het
Kif21a	A	G	15: 90,956,473	Y1147H	probably damaging	Het
Kndc1	A	G	7: 139,939,914	K1729E	probably damaging	Het
Map4k1	G	A	7: 28,994,071	R433H	probably benign	Het
Mettl14	T	C	3: 123,374,038	I224V	probably benign	Het
Mgat5b	A	G	11: 116,978,473	N614S	probably benign	Het
Mlh3	C	T	12: 85,266,230	V1061I	probably benign	Het
Myo1h	T	C	5: 114,359,527	V27A	probably damaging	Het
Naip5	A	T	13: 100,221,859	H956Q	probably benign	Het
Olfr1341	A	G	4: 118,709,923	N172S	probably damaging	Het
Olfr746	A	T	14: 50,653,644	M136L	probably damaging	Het
Papd4	A	G	13: 93,184,104	I147T	probably benign	Het
Pcdh7	A	T	5: 57,913,171	T1064S	possibly damaging	Het
Peg3	T	C	7: 6,711,281	E314G	probably benign	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Pgr	A	T	9: 8,922,644	D605V	probably damaging	Het
Prdm2	T	C	4: 143,134,009	S904G	possibly damaging	Het
Serpinb3c	T	A	1: 107,272,738	Q225L	probably damaging	Het
Soga3	T	A	10: 29,146,752	C32S	probably benign	Het
Strn3	A	C	12: 51,650,173	D258E	probably damaging	Het
Tgm2	C	T	2: 158,143,129	R19H	probably benign	Het
Themis	T	A	10: 28,668,752		probably null	Het
Trim28	C	T	7: 13,030,518	P753S	probably damaging	Het
Vac14	C	T	8: 110,715,438	Q683*	probably null	Het
Vwa1	G	A	4: 155,772,879	P154L	probably damaging	Het
Zfp541	T	C	7: 16,079,111	I563T	possibly damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75503431	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CTATAGAGTAACTATCCACAAGGTGAG -3'
(R):5'- AGGCTGGCTTCAAACTTGC -3'

Sequencing Primer
(F):5'- GTAACTATCCACAAGGTGAGTCTCG -3'
(R):5'- GCTGGCTTCAAACTTGCAAAGATC -3'

Posted On

2022-07-18