Incidental Mutation 'R9519:Aox2'
ID 718738
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9519 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 58334767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 862 (K862N)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably damaging
Transcript: ENSMUST00000114366
AA Change: K862N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: K862N

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T C 5: 76,882,725 E676G probably benign Het
Aatk G A 11: 120,021,483 probably benign Het
Abcc1 T C 16: 14,389,817 V20A probably benign Het
Abcc3 A G 11: 94,373,979 V181A possibly damaging Het
Alkbh2 T C 5: 114,127,733 K3E probably benign Het
Arap1 G A 7: 101,394,739 probably benign Het
Arid2 A G 15: 96,289,067 N67D possibly damaging Het
Atxn1l C T 8: 109,732,056 V525M probably damaging Het
Bcan C G 3: 87,995,657 E271D probably damaging Het
Bcan C A 3: 87,995,660 E270D probably damaging Het
Bcan T C 3: 87,995,661 E270G probably benign Het
Cadps T C 14: 12,546,290 H522R possibly damaging Het
Dll3 A G 7: 28,296,339 S346P probably damaging Het
Epha3 T A 16: 63,652,305 T406S possibly damaging Het
Far1 A G 7: 113,551,352 R296G probably benign Het
Flot1 T G 17: 35,825,471 V172G possibly damaging Het
Gm973 A G 1: 59,541,452 M165V probably benign Het
Golm1 T C 13: 59,645,100 H197R probably benign Het
Gpr85 T C 6: 13,836,999 probably benign Het
Herc1 A G 9: 66,400,074 K1017E probably damaging Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Jmjd1c A G 10: 67,158,019 D93G possibly damaging Het
Kcnn4 T A 7: 24,382,516 V363E probably damaging Het
Kif9 A G 9: 110,521,276 D745G probably damaging Het
Lipm T C 19: 34,112,992 M191T probably benign Het
Ltbp1 C T 17: 75,385,195 R1603C probably damaging Het
Ms4a13 C G 19: 11,169,968 S194T unknown Het
Muc16 A T 9: 18,586,920 I6577N probably benign Het
Nfatc2 T C 2: 168,570,758 T336A probably benign Het
Nlrp9c T A 7: 26,385,877 K92N possibly damaging Het
Olfr404-ps1 A T 11: 74,240,001 T146S probably benign Het
Olfr642 C A 7: 104,049,429 M308I probably benign Het
Parp16 T A 9: 65,229,940 Y149* probably null Het
Pdgfra A T 5: 75,176,689 T463S probably benign Het
Peg3 T C 7: 6,711,395 E276G probably benign Het
Prom1 A G 5: 44,056,061 V110A possibly damaging Het
Ptprq T C 10: 107,685,100 Y737C probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sds T A 5: 120,481,545 L173Q probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc8a3 A T 12: 81,315,552 D164E probably benign Het
Slc9c1 A T 16: 45,575,407 N607I probably damaging Het
Smarce1 A T 11: 99,214,107 I248K probably benign Het
Smg7 G T 1: 152,859,445 T213K probably damaging Het
Snrnp70 C T 7: 45,387,451 D90N probably benign Het
Snx20 A G 8: 88,627,772 V110A possibly damaging Het
Snx25 A G 8: 46,033,746 V986A probably damaging Het
Soat1 T C 1: 156,432,209 K521E probably benign Het
Speg C T 1: 75,415,736 T1679M probably damaging Het
Stoml3 T A 3: 53,497,981 F28I probably benign Het
Sult1d1 A T 5: 87,556,862 M256K probably damaging Het
Tiam1 T C 16: 89,811,934 E1064G probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Zfp790 C A 7: 29,823,142 H3N unknown Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCAATAATCCATATCATGCCTAGAAG -3'
(R):5'- TCAAGCAATGCCTTTAAGTTACTAC -3'

Sequencing Primer
(F):5'- ACTTGAATAAGTAGGTGGATATGTGC -3'
(R):5'- GTCATGGGCATCCAAAAT -3'
Posted On 2022-07-18