Incidental Mutation 'R9519:Kif9'
ID 718774
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R9519 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110476958-110525179 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110521276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 745 (D745G)
Ref Sequence ENSEMBL: ENSMUSP00000057896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
AlphaFold Q9WV04
Predicted Effect probably damaging
Transcript: ENSMUST00000061155
AA Change: D745G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: D745G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084952
AA Change: D745G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: D745G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197248
AA Change: D745G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: D745G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T C 5: 76,882,725 E676G probably benign Het
Aatk G A 11: 120,021,483 probably benign Het
Abcc1 T C 16: 14,389,817 V20A probably benign Het
Abcc3 A G 11: 94,373,979 V181A possibly damaging Het
Alkbh2 T C 5: 114,127,733 K3E probably benign Het
Aox2 A C 1: 58,334,767 K862N probably damaging Het
Arap1 G A 7: 101,394,739 probably benign Het
Arid2 A G 15: 96,289,067 N67D possibly damaging Het
Atxn1l C T 8: 109,732,056 V525M probably damaging Het
Bcan C G 3: 87,995,657 E271D probably damaging Het
Bcan C A 3: 87,995,660 E270D probably damaging Het
Bcan T C 3: 87,995,661 E270G probably benign Het
Cadps T C 14: 12,546,290 H522R possibly damaging Het
Dll3 A G 7: 28,296,339 S346P probably damaging Het
Epha3 T A 16: 63,652,305 T406S possibly damaging Het
Far1 A G 7: 113,551,352 R296G probably benign Het
Flot1 T G 17: 35,825,471 V172G possibly damaging Het
Gm973 A G 1: 59,541,452 M165V probably benign Het
Golm1 T C 13: 59,645,100 H197R probably benign Het
Gpr85 T C 6: 13,836,999 probably benign Het
Herc1 A G 9: 66,400,074 K1017E probably damaging Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Jmjd1c A G 10: 67,158,019 D93G possibly damaging Het
Kcnn4 T A 7: 24,382,516 V363E probably damaging Het
Lipm T C 19: 34,112,992 M191T probably benign Het
Ltbp1 C T 17: 75,385,195 R1603C probably damaging Het
Ms4a13 C G 19: 11,169,968 S194T unknown Het
Muc16 A T 9: 18,586,920 I6577N probably benign Het
Nfatc2 T C 2: 168,570,758 T336A probably benign Het
Nlrp9c T A 7: 26,385,877 K92N possibly damaging Het
Olfr404-ps1 A T 11: 74,240,001 T146S probably benign Het
Olfr642 C A 7: 104,049,429 M308I probably benign Het
Parp16 T A 9: 65,229,940 Y149* probably null Het
Pdgfra A T 5: 75,176,689 T463S probably benign Het
Peg3 T C 7: 6,711,395 E276G probably benign Het
Prom1 A G 5: 44,056,061 V110A possibly damaging Het
Ptprq T C 10: 107,685,100 Y737C probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sds T A 5: 120,481,545 L173Q probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc8a3 A T 12: 81,315,552 D164E probably benign Het
Slc9c1 A T 16: 45,575,407 N607I probably damaging Het
Smarce1 A T 11: 99,214,107 I248K probably benign Het
Smg7 G T 1: 152,859,445 T213K probably damaging Het
Snrnp70 C T 7: 45,387,451 D90N probably benign Het
Snx20 A G 8: 88,627,772 V110A possibly damaging Het
Snx25 A G 8: 46,033,746 V986A probably damaging Het
Soat1 T C 1: 156,432,209 K521E probably benign Het
Speg C T 1: 75,415,736 T1679M probably damaging Het
Stoml3 T A 3: 53,497,981 F28I probably benign Het
Sult1d1 A T 5: 87,556,862 M256K probably damaging Het
Tiam1 T C 16: 89,811,934 E1064G probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Zfp790 C A 7: 29,823,142 H3N unknown Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110489966 missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4247:Kif9 UTSW 9 110495959 critical splice donor site probably null
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5362:Kif9 UTSW 9 110489944 missense probably damaging 0.99
R5379:Kif9 UTSW 9 110521303 missense probably benign 0.00
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 splice site probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
R7459:Kif9 UTSW 9 110519041 missense probably damaging 1.00
R7593:Kif9 UTSW 9 110521353 missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110514614 missense not run
R8050:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R8370:Kif9 UTSW 9 110488613 missense probably damaging 1.00
R8549:Kif9 UTSW 9 110514419 splice site probably null
R8751:Kif9 UTSW 9 110501656 missense probably benign 0.03
R8830:Kif9 UTSW 9 110524930 missense probably damaging 1.00
R9489:Kif9 UTSW 9 110517642 missense probably benign 0.01
R9605:Kif9 UTSW 9 110517642 missense probably benign 0.01
R9776:Kif9 UTSW 9 110521330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTTCTGCAGTGCCCAGGTG -3'
(R):5'- TCAATCTTCCTGGGCTGGTAC -3'

Sequencing Primer
(F):5'- AGGTGGCCCTTACAGAGG -3'
(R):5'- ACACCCTGTGCCTATCTAATGGAG -3'
Posted On 2022-07-18