Incidental Mutation 'R9521:Mios'
ID 718880
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Name meiosis regulator for oocyte development
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock # R9521 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 8209222-8236274 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8233171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 773 (T773I)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
AlphaFold Q8VE19
Predicted Effect probably benign
Transcript: ENSMUST00000040017
AA Change: T773I

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: T773I

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,472,242 probably null Het
A030005K14Rik C A 1: 83,059,259 G17V unknown Het
Afap1l1 C T 18: 61,746,792 A336T probably benign Het
Akap8 C T 17: 32,311,062 R395H possibly damaging Het
Ankrd26 G A 6: 118,540,459 A467V possibly damaging Het
Ano9 A T 7: 141,102,314 S683T probably benign Het
Aox3 C A 1: 58,125,063 A164E probably benign Het
Apc T C 18: 34,312,685 I878T probably benign Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Atg9b T C 5: 24,388,109 N432S probably benign Het
Atp1b3 A G 9: 96,345,858 F49L probably damaging Het
Cacnb2 A T 2: 14,604,327 probably benign Het
Ccdc180 T A 4: 45,916,283 L828Q probably null Het
Chd3 C T 11: 69,358,307 R748Q probably benign Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cldn18 T A 9: 99,698,975 probably null Het
Cmklr1 C T 5: 113,614,419 V174I probably benign Het
Cyp2d22 A T 15: 82,372,487 V362D probably damaging Het
Dock10 T C 1: 80,524,046 K1810R probably damaging Het
Duox1 T A 2: 122,328,735 V661E possibly damaging Het
Ercc2 G A 7: 19,391,974 R518Q probably damaging Het
Fam186a A G 15: 99,943,590 L1591P probably damaging Het
Fam186b G T 15: 99,280,538 D302E probably benign Het
Fap T C 2: 62,542,156 D326G probably benign Het
Gm42669 T A 5: 107,508,026 D135E Het
Keap1 A T 9: 21,231,840 V463E probably damaging Het
Mga T C 2: 119,964,498 S2888P probably damaging Het
Mgam A G 6: 40,745,184 D403G probably damaging Het
Nav3 T C 10: 109,999,984 D79G possibly damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1082 C A 2: 86,594,427 V134F Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Orc6 T C 8: 85,299,986 V20A possibly damaging Het
Peli2 A G 14: 48,252,595 K175E probably benign Het
Plec C G 15: 76,178,724 R2382P possibly damaging Het
Ppp1r12b T A 1: 134,777,325 D875V probably damaging Het
Pramel6 T A 2: 87,510,285 C320* probably null Het
Qrich2 A T 11: 116,448,382 M26K probably damaging Het
Rapgef1 A G 2: 29,734,279 I1006V probably benign Het
Rasgrp3 T A 17: 75,514,163 L455Q probably null Het
Scaf8 C T 17: 3,198,010 R1203W probably damaging Het
Senp6 C T 9: 80,067,405 probably benign Het
Senp7 A G 16: 56,171,781 Y700C probably damaging Het
Siglec1 A G 2: 131,073,326 probably null Het
Slc12a7 G A 13: 73,798,968 V592I probably benign Het
Slfn3 T C 11: 83,212,999 V232A probably benign Het
Tdp1 T C 12: 99,911,647 V396A probably damaging Het
Ticam1 T C 17: 56,271,388 T236A probably benign Het
Tob1 AGCAGCAGCAGCAGCAGCAGCCGTCATCATCCCAGCCGCCGCCTCCACTACCGCAGCAGCAGCAGCAGCAGCC AGCAGCAGCAGCAGCAGCAGCC 11: 94,214,379 probably benign Het
Ttc21a C A 9: 119,958,115 D729E probably damaging Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Unc45b A G 11: 82,917,760 D224G probably benign Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn2r61 A G 7: 42,267,202 E413G probably damaging Het
Zfp423 A T 8: 87,782,405 L437Q probably damaging Het
Zfp810 A G 9: 22,278,931 V227A possibly damaging Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8234363 critical splice donor site probably null
IGL01365:Mios APN 6 8216089 nonsense probably null
IGL01548:Mios APN 6 8234252 missense possibly damaging 0.90
IGL01898:Mios APN 6 8222668 missense probably benign 0.03
IGL02110:Mios APN 6 8215565 missense probably damaging 1.00
IGL02308:Mios APN 6 8231269 missense probably benign 0.06
IGL02375:Mios APN 6 8222598 missense probably benign 0.02
IGL02452:Mios APN 6 8222492 missense probably benign 0.01
IGL02670:Mios APN 6 8235378 splice site probably benign
IGL03083:Mios APN 6 8215156 missense probably damaging 1.00
R0462:Mios UTSW 6 8215743 missense probably benign 0.11
R0591:Mios UTSW 6 8215470 missense possibly damaging 0.52
R1351:Mios UTSW 6 8228120 missense possibly damaging 0.70
R1476:Mios UTSW 6 8234237 missense probably benign 0.01
R1802:Mios UTSW 6 8216385 nonsense probably null
R1959:Mios UTSW 6 8215437 missense probably benign 0.17
R1964:Mios UTSW 6 8215798 missense probably damaging 0.99
R2272:Mios UTSW 6 8226865 missense possibly damaging 0.71
R2915:Mios UTSW 6 8214935 missense possibly damaging 0.72
R3852:Mios UTSW 6 8216453 missense probably benign 0.09
R3876:Mios UTSW 6 8233189 missense probably damaging 0.98
R3948:Mios UTSW 6 8215496 missense probably benign
R4698:Mios UTSW 6 8228113 missense possibly damaging 0.60
R4785:Mios UTSW 6 8222464 missense probably benign
R4789:Mios UTSW 6 8235429 missense probably benign 0.06
R4866:Mios UTSW 6 8214857 missense probably damaging 1.00
R4878:Mios UTSW 6 8215094 missense probably benign 0.00
R4991:Mios UTSW 6 8215847 missense probably benign 0.00
R5479:Mios UTSW 6 8215314 missense probably benign 0.00
R5714:Mios UTSW 6 8215434 missense probably damaging 0.99
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6111:Mios UTSW 6 8214836 missense probably benign 0.01
R6455:Mios UTSW 6 8231239 missense probably benign 0.03
R7381:Mios UTSW 6 8216064 missense probably damaging 0.98
R8350:Mios UTSW 6 8227998 missense probably benign 0.00
R8708:Mios UTSW 6 8234255 missense probably benign 0.17
R8913:Mios UTSW 6 8215924 missense probably benign
R9062:Mios UTSW 6 8233221 missense probably benign 0.00
R9359:Mios UTSW 6 8214894 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCTAGTCAGATGGATTACTTTGC -3'
(R):5'- TGAAATACCAGTAGGAGCCATG -3'

Sequencing Primer
(F):5'- CAGATGGATTACTTTGCAATGTAAAG -3'
(R):5'- TCAACTTTAAGTTAGCATCTGTGAG -3'
Posted On 2022-07-18