Incidental Mutation 'R9522:Cse1l'
ID 718932
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 166934753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 495 (V495I)
Ref Sequence ENSEMBL: ENSMUSP00000002790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: V495I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: V495I

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: V210I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: V210I

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: V439I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: V439I

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,466,123 S5C probably damaging Het
5830411N06Rik T A 7: 140,274,074 I330N possibly damaging Het
Abca14 A T 7: 120,248,145 Y744F probably null Het
Adam17 C A 12: 21,345,692 V277F probably damaging Het
Adcy8 C T 15: 64,920,711 C132Y probably damaging Het
Adgrf3 G A 5: 30,199,484 P318L possibly damaging Het
Ahcyl1 A T 3: 107,672,082 I212N probably damaging Het
Allc A T 12: 28,570,654 F33I probably damaging Het
Arhgap32 A G 9: 32,116,154 T7A probably benign Het
Bbs4 A G 9: 59,353,408 probably null Het
Btbd1 G T 7: 81,829,333 P20H unknown Het
Cass4 A G 2: 172,427,428 I477V possibly damaging Het
Cep83 A G 10: 94,750,322 E362G probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cntnap5b A G 1: 100,484,622 D896G probably benign Het
Crocc2 T C 1: 93,189,707 V305A probably benign Het
Ctsj A T 13: 61,004,443 Y36* probably null Het
Ctss T G 3: 95,546,798 D220E probably benign Het
Ctu1 T C 7: 43,675,476 L113P probably benign Het
Cyp2d40 G A 15: 82,764,073 A13V possibly damaging Het
Dhrs4 A T 14: 55,478,762 probably benign Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dpysl5 C A 5: 30,778,055 Y167* probably null Het
E4f1 C T 17: 24,447,122 G234D probably damaging Het
Eif3g G T 9: 20,898,155 T27N probably benign Het
Eif3g T A 9: 20,898,156 T27S probably benign Het
Fcrls A G 3: 87,256,794 F343L possibly damaging Het
Fdft1 T C 14: 63,159,148 probably null Het
Gm4450 T C 3: 98,446,467 S239G probably benign Het
Gm960 T C 19: 4,627,246 H612R probably benign Het
Igf2r G T 17: 12,698,328 Q1562K probably benign Het
Ilf3 G A 9: 21,394,237 V232I probably benign Het
Irx5 C T 8: 92,360,631 T397M possibly damaging Het
Kif16b A T 2: 142,849,907 V219D probably damaging Het
Klkb1 T C 8: 45,277,015 I276M probably benign Het
Large2 A G 2: 92,369,921 L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 D61G probably benign Het
Map7 A G 10: 20,229,896 Y31C possibly damaging Het
Moxd2 T A 6: 40,880,441 I462F probably benign Het
Olfr1158 G A 2: 87,990,831 C240Y probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1450 T A 19: 12,954,013 C141* probably null Het
Phf20l1 T C 15: 66,632,820 V770A possibly damaging Het
Ppfia4 G A 1: 134,313,148 A819V probably damaging Het
Qrfpr A G 3: 36,182,527 W242R probably damaging Het
Rgs3 A G 4: 62,605,492 I53M probably benign Het
Rif1 T C 2: 52,081,299 F263S probably damaging Het
Rpl22l1 T C 3: 28,806,594 probably null Het
Ryr3 T A 2: 112,730,414 I3001F probably benign Het
Safb2 A G 17: 56,566,900 I675T probably damaging Het
Sec16b C T 1: 157,564,765 S901L probably damaging Het
Setd5 T G 6: 113,115,034 I272S probably damaging Het
Slc40a1 A T 1: 45,909,512 M536K probably damaging Het
Slfn3 T C 11: 83,212,999 V232A probably benign Het
Spata31d1b T C 13: 59,716,966 S643P probably benign Het
Tbc1d23 T C 16: 57,198,744 D251G probably benign Het
Tbccd1 T C 16: 22,822,499 E376G possibly damaging Het
Tmem184a G T 5: 139,805,730 P368T probably benign Het
Top1mt T C 15: 75,667,460 D362G probably damaging Het
Ugt3a2 C A 15: 9,370,123 P451H probably damaging Het
Unc80 G A 1: 66,638,062 C2050Y possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r179 T C 7: 23,928,777 V131A probably damaging Het
Wdr89 A G 12: 75,633,150 F110S probably damaging Het
Znrf3 T C 11: 5,282,379 Y282C probably damaging Het
Zscan18 T C 7: 12,769,370 D754G possibly damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8001:Cse1l UTSW 2 166939913 missense probably damaging 1.00
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9599:Cse1l UTSW 2 166941466 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAATAAACCGTGCTTGGGAAC -3'
(R):5'- TTAGGAAAACACCCTGAGACATCTC -3'

Sequencing Primer
(F):5'- TGCTTGGGAACACAGCC -3'
(R):5'- AGTAAGGTATACCCCTCTGCCTTAAG -3'
Posted On 2022-07-18