Incidental Mutation 'R9522:Adgrf3'
ID 718942
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms Gpr113, LOC381628, PGR23
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30193431-30205722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30199484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 318 (P318L)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect possibly damaging
Transcript: ENSMUST00000088117
AA Change: P318L

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: P318L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,466,123 S5C probably damaging Het
5830411N06Rik T A 7: 140,274,074 I330N possibly damaging Het
Abca14 A T 7: 120,248,145 Y744F probably null Het
Adam17 C A 12: 21,345,692 V277F probably damaging Het
Adcy8 C T 15: 64,920,711 C132Y probably damaging Het
Ahcyl1 A T 3: 107,672,082 I212N probably damaging Het
Allc A T 12: 28,570,654 F33I probably damaging Het
Arhgap32 A G 9: 32,116,154 T7A probably benign Het
Bbs4 A G 9: 59,353,408 probably null Het
Btbd1 G T 7: 81,829,333 P20H unknown Het
Cass4 A G 2: 172,427,428 I477V possibly damaging Het
Cep83 A G 10: 94,750,322 E362G probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cntnap5b A G 1: 100,484,622 D896G probably benign Het
Crocc2 T C 1: 93,189,707 V305A probably benign Het
Cse1l G A 2: 166,934,753 V495I probably benign Het
Ctsj A T 13: 61,004,443 Y36* probably null Het
Ctss T G 3: 95,546,798 D220E probably benign Het
Ctu1 T C 7: 43,675,476 L113P probably benign Het
Cyp2d40 G A 15: 82,764,073 A13V possibly damaging Het
Dhrs4 A T 14: 55,478,762 probably benign Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dpysl5 C A 5: 30,778,055 Y167* probably null Het
E4f1 C T 17: 24,447,122 G234D probably damaging Het
Eif3g G T 9: 20,898,155 T27N probably benign Het
Eif3g T A 9: 20,898,156 T27S probably benign Het
Fcrls A G 3: 87,256,794 F343L possibly damaging Het
Fdft1 T C 14: 63,159,148 probably null Het
Gm4450 T C 3: 98,446,467 S239G probably benign Het
Gm960 T C 19: 4,627,246 H612R probably benign Het
Igf2r G T 17: 12,698,328 Q1562K probably benign Het
Ilf3 G A 9: 21,394,237 V232I probably benign Het
Irx5 C T 8: 92,360,631 T397M possibly damaging Het
Kif16b A T 2: 142,849,907 V219D probably damaging Het
Klkb1 T C 8: 45,277,015 I276M probably benign Het
Large2 A G 2: 92,369,921 L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 D61G probably benign Het
Map7 A G 10: 20,229,896 Y31C possibly damaging Het
Moxd2 T A 6: 40,880,441 I462F probably benign Het
Olfr1158 G A 2: 87,990,831 C240Y probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1450 T A 19: 12,954,013 C141* probably null Het
Phf20l1 T C 15: 66,632,820 V770A possibly damaging Het
Ppfia4 G A 1: 134,313,148 A819V probably damaging Het
Qrfpr A G 3: 36,182,527 W242R probably damaging Het
Rgs3 A G 4: 62,605,492 I53M probably benign Het
Rif1 T C 2: 52,081,299 F263S probably damaging Het
Rpl22l1 T C 3: 28,806,594 probably null Het
Ryr3 T A 2: 112,730,414 I3001F probably benign Het
Safb2 A G 17: 56,566,900 I675T probably damaging Het
Sec16b C T 1: 157,564,765 S901L probably damaging Het
Setd5 T G 6: 113,115,034 I272S probably damaging Het
Slc40a1 A T 1: 45,909,512 M536K probably damaging Het
Slfn3 T C 11: 83,212,999 V232A probably benign Het
Spata31d1b T C 13: 59,716,966 S643P probably benign Het
Tbc1d23 T C 16: 57,198,744 D251G probably benign Het
Tbccd1 T C 16: 22,822,499 E376G possibly damaging Het
Tmem184a G T 5: 139,805,730 P368T probably benign Het
Top1mt T C 15: 75,667,460 D362G probably damaging Het
Ugt3a2 C A 15: 9,370,123 P451H probably damaging Het
Unc80 G A 1: 66,638,062 C2050Y possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r179 T C 7: 23,928,777 V131A probably damaging Het
Wdr89 A G 12: 75,633,150 F110S probably damaging Het
Znrf3 T C 11: 5,282,379 Y282C probably damaging Het
Zscan18 T C 7: 12,769,370 D754G possibly damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30197303 missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30198581 unclassified probably benign
R8857:Adgrf3 UTSW 5 30197067 nonsense probably null
R8926:Adgrf3 UTSW 5 30200448 missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30195073 missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30196959 missense probably benign 0.01
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGACTCAGTGGCTCAAGGTAC -3'
(R):5'- CCAAATTCTGAACCAGCAGTTG -3'

Sequencing Primer
(F):5'- TGGCTCAAGGTACAGGGATAAC -3'
(R):5'- AGTTGGAGGCTAGCATCCCATC -3'
Posted On 2022-07-18