Incidental Mutation 'R9522:Setd5'
ID 718948
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene Name SET domain containing 5
Synonyms 2900045N06Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 113054326-113130393 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 113091995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 272 (I272S)
Ref Sequence ENSEMBL: ENSMUSP00000108780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
AlphaFold Q5XJV7
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: I253S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: I253S

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: I272S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: I272S

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: I272S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: I272S

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,847,368 (GRCm39) Y744F probably null Het
Adam17 C A 12: 21,395,693 (GRCm39) V277F probably damaging Het
Adcy8 C T 15: 64,792,560 (GRCm39) C132Y probably damaging Het
Adgrf3 G A 5: 30,404,482 (GRCm39) P318L possibly damaging Het
Ahcyl1 A T 3: 107,579,398 (GRCm39) I212N probably damaging Het
Allc A T 12: 28,620,653 (GRCm39) F33I probably damaging Het
Arhgap32 A G 9: 32,027,450 (GRCm39) T7A probably benign Het
Bbs4 A G 9: 59,260,691 (GRCm39) probably null Het
Btbd1 G T 7: 81,479,081 (GRCm39) P20H unknown Het
Cass4 A G 2: 172,269,348 (GRCm39) I477V possibly damaging Het
Cep83 A G 10: 94,586,184 (GRCm39) E362G probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Cimip2c A T 5: 30,623,467 (GRCm39) S5C probably damaging Het
Cntnap5b A G 1: 100,412,347 (GRCm39) D896G probably benign Het
Crocc2 T C 1: 93,117,429 (GRCm39) V305A probably benign Het
Cse1l G A 2: 166,776,673 (GRCm39) V495I probably benign Het
Ctsj A T 13: 61,152,257 (GRCm39) Y36* probably null Het
Ctss T G 3: 95,454,109 (GRCm39) D220E probably benign Het
Ctu1 T C 7: 43,324,900 (GRCm39) L113P probably benign Het
Cyp2d40 G A 15: 82,648,274 (GRCm39) A13V possibly damaging Het
Dhrs4 A T 14: 55,716,219 (GRCm39) probably benign Het
Dlgap4 G T 2: 156,546,514 (GRCm39) R394L possibly damaging Het
Dpysl5 C A 5: 30,935,399 (GRCm39) Y167* probably null Het
E4f1 C T 17: 24,666,096 (GRCm39) G234D probably damaging Het
Eif3g G T 9: 20,809,451 (GRCm39) T27N probably benign Het
Eif3g T A 9: 20,809,452 (GRCm39) T27S probably benign Het
Fcrl2 A G 3: 87,164,101 (GRCm39) F343L possibly damaging Het
Fdft1 T C 14: 63,396,597 (GRCm39) probably null Het
Hsd3b9 T C 3: 98,353,783 (GRCm39) S239G probably benign Het
Igf2r G T 17: 12,917,215 (GRCm39) Q1562K probably benign Het
Ilf3 G A 9: 21,305,533 (GRCm39) V232I probably benign Het
Irx5 C T 8: 93,087,259 (GRCm39) T397M possibly damaging Het
Kif16b A T 2: 142,691,827 (GRCm39) V219D probably damaging Het
Klkb1 T C 8: 45,730,052 (GRCm39) I276M probably benign Het
Large2 A G 2: 92,200,266 (GRCm39) L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 (GRCm38) D61G probably benign Het
Map7 A G 10: 20,105,642 (GRCm39) Y31C possibly damaging Het
Moxd2 T A 6: 40,857,375 (GRCm39) I462F probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or5b98 T A 19: 12,931,377 (GRCm39) C141* probably null Het
Or9m2 G A 2: 87,821,175 (GRCm39) C240Y probably damaging Het
Phf20l1 T C 15: 66,504,669 (GRCm39) V770A possibly damaging Het
Ppfia4 G A 1: 134,240,886 (GRCm39) A819V probably damaging Het
Qrfpr A G 3: 36,236,676 (GRCm39) W242R probably damaging Het
Rgs3 A G 4: 62,523,729 (GRCm39) I53M probably benign Het
Rif1 T C 2: 51,971,311 (GRCm39) F263S probably damaging Het
Rpl22l1 T C 3: 28,860,743 (GRCm39) probably null Het
Ryr3 T A 2: 112,560,759 (GRCm39) I3001F probably benign Het
Safb2 A G 17: 56,873,900 (GRCm39) I675T probably damaging Het
Scart2 T A 7: 139,853,987 (GRCm39) I330N possibly damaging Het
Sec16b C T 1: 157,392,335 (GRCm39) S901L probably damaging Het
Slc40a1 A T 1: 45,948,672 (GRCm39) M536K probably damaging Het
Slfn3 T C 11: 83,103,825 (GRCm39) V232A probably benign Het
Spata31d1b T C 13: 59,864,780 (GRCm39) S643P probably benign Het
Tbc1d23 T C 16: 57,019,107 (GRCm39) D251G probably benign Het
Tbccd1 T C 16: 22,641,249 (GRCm39) E376G possibly damaging Het
Tmem184a G T 5: 139,791,485 (GRCm39) P368T probably benign Het
Top1mt T C 15: 75,539,309 (GRCm39) D362G probably damaging Het
Top6bl T C 19: 4,677,274 (GRCm39) H612R probably benign Het
Ugt3a1 C A 15: 9,370,209 (GRCm39) P451H probably damaging Het
Unc80 G A 1: 66,677,221 (GRCm39) C2050Y possibly damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vmn1r179 T C 7: 23,628,202 (GRCm39) V131A probably damaging Het
Wdr89 A G 12: 75,679,924 (GRCm39) F110S probably damaging Het
Znrf3 T C 11: 5,232,379 (GRCm39) Y282C probably damaging Het
Zscan18 T C 7: 12,503,297 (GRCm39) D754G possibly damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113,088,375 (GRCm39) missense probably damaging 1.00
IGL02102:Setd5 APN 6 113,127,946 (GRCm39) nonsense probably null
IGL02105:Setd5 APN 6 113,094,541 (GRCm39) missense probably damaging 1.00
IGL02202:Setd5 APN 6 113,127,976 (GRCm39) missense probably benign 0.01
IGL02221:Setd5 APN 6 113,098,131 (GRCm39) splice site probably benign
IGL02382:Setd5 APN 6 113,120,601 (GRCm39) missense probably benign
IGL02394:Setd5 APN 6 113,087,859 (GRCm39) missense probably benign 0.00
IGL02442:Setd5 APN 6 113,087,341 (GRCm39) missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113,120,770 (GRCm39) missense probably damaging 1.00
IGL02940:Setd5 APN 6 113,091,899 (GRCm39) missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113,088,442 (GRCm39) missense probably damaging 1.00
R0479:Setd5 UTSW 6 113,091,994 (GRCm39) missense probably damaging 1.00
R0514:Setd5 UTSW 6 113,096,398 (GRCm39) nonsense probably null
R1528:Setd5 UTSW 6 113,098,699 (GRCm39) missense probably damaging 0.99
R1530:Setd5 UTSW 6 113,086,874 (GRCm39) missense probably damaging 1.00
R2176:Setd5 UTSW 6 113,128,114 (GRCm39) missense probably benign 0.23
R2191:Setd5 UTSW 6 113,088,390 (GRCm39) nonsense probably null
R2286:Setd5 UTSW 6 113,096,571 (GRCm39) missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113,096,545 (GRCm39) missense probably benign
R4294:Setd5 UTSW 6 113,088,281 (GRCm39) intron probably benign
R4300:Setd5 UTSW 6 113,127,123 (GRCm39) missense probably damaging 1.00
R4342:Setd5 UTSW 6 113,088,281 (GRCm39) intron probably benign
R4370:Setd5 UTSW 6 113,098,766 (GRCm39) missense probably damaging 1.00
R4854:Setd5 UTSW 6 113,128,360 (GRCm39) missense probably damaging 1.00
R4858:Setd5 UTSW 6 113,126,527 (GRCm39) missense probably damaging 1.00
R5057:Setd5 UTSW 6 113,114,922 (GRCm39) missense probably damaging 0.96
R5345:Setd5 UTSW 6 113,092,968 (GRCm39) missense probably damaging 1.00
R5529:Setd5 UTSW 6 113,098,529 (GRCm39) missense probably damaging 1.00
R5556:Setd5 UTSW 6 113,124,463 (GRCm39) missense probably benign 0.00
R5582:Setd5 UTSW 6 113,091,886 (GRCm39) missense probably damaging 1.00
R5838:Setd5 UTSW 6 113,096,396 (GRCm39) missense probably benign 0.40
R5941:Setd5 UTSW 6 113,105,451 (GRCm39) missense probably damaging 1.00
R6009:Setd5 UTSW 6 113,087,480 (GRCm39) missense probably damaging 0.99
R6146:Setd5 UTSW 6 113,098,773 (GRCm39) critical splice donor site probably null
R6394:Setd5 UTSW 6 113,092,505 (GRCm39) missense probably damaging 1.00
R6694:Setd5 UTSW 6 113,120,669 (GRCm39) missense probably benign
R7058:Setd5 UTSW 6 113,092,532 (GRCm39) missense probably benign 0.16
R7060:Setd5 UTSW 6 113,094,343 (GRCm39) missense probably damaging 1.00
R7199:Setd5 UTSW 6 113,098,099 (GRCm39) missense probably benign 0.03
R7238:Setd5 UTSW 6 113,098,091 (GRCm39) missense probably damaging 1.00
R7296:Setd5 UTSW 6 113,124,518 (GRCm39) missense probably benign 0.21
R7438:Setd5 UTSW 6 113,092,043 (GRCm39) missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113,087,850 (GRCm39) missense probably damaging 1.00
R7621:Setd5 UTSW 6 113,121,010 (GRCm39) missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113,098,725 (GRCm39) missense probably damaging 1.00
R7986:Setd5 UTSW 6 113,105,418 (GRCm39) missense probably benign 0.00
R8083:Setd5 UTSW 6 113,091,971 (GRCm39) missense probably damaging 1.00
R8175:Setd5 UTSW 6 113,091,874 (GRCm39) missense probably damaging 1.00
R8252:Setd5 UTSW 6 113,127,916 (GRCm39) missense probably benign 0.01
R8268:Setd5 UTSW 6 113,126,651 (GRCm39) critical splice donor site probably null
R8271:Setd5 UTSW 6 113,092,031 (GRCm39) missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113,126,644 (GRCm39) missense probably benign 0.12
R8508:Setd5 UTSW 6 113,098,048 (GRCm39) missense probably damaging 1.00
R8801:Setd5 UTSW 6 113,127,853 (GRCm39) missense possibly damaging 0.95
R8864:Setd5 UTSW 6 113,088,469 (GRCm39) missense probably damaging 1.00
R9227:Setd5 UTSW 6 113,098,755 (GRCm39) missense possibly damaging 0.92
R9588:Setd5 UTSW 6 113,121,025 (GRCm39) missense probably damaging 1.00
R9660:Setd5 UTSW 6 113,128,366 (GRCm39) missense probably benign 0.13
R9711:Setd5 UTSW 6 113,093,063 (GRCm39) missense probably damaging 1.00
R9728:Setd5 UTSW 6 113,128,366 (GRCm39) missense probably benign 0.13
X0017:Setd5 UTSW 6 113,127,129 (GRCm39) missense probably null 1.00
Z1176:Setd5 UTSW 6 113,115,057 (GRCm39) missense probably benign
Z1191:Setd5 UTSW 6 113,091,957 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCTCGGAAGCACAGAATTTAG -3'
(R):5'- TCAAACATGTGCCTAGACAGTTTAG -3'

Sequencing Primer
(F):5'- TTTAGATGAAAATACCACTGAGGGC -3'
(R):5'- CCTGATTTTGAACAGAGATTATCAGC -3'
Posted On 2022-07-18