Incidental Mutation 'R9522:Setd5'
ID 718948
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene Name SET domain containing 5
Synonyms 2900045N06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 113077365-113153435 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 113115034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 272 (I272S)
Ref Sequence ENSEMBL: ENSMUSP00000108780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
AlphaFold Q5XJV7
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: I253S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: I253S

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: I272S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: I272S

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: I272S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: I272S

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,466,123 S5C probably damaging Het
5830411N06Rik T A 7: 140,274,074 I330N possibly damaging Het
Abca14 A T 7: 120,248,145 Y744F probably null Het
Adam17 C A 12: 21,345,692 V277F probably damaging Het
Adcy8 C T 15: 64,920,711 C132Y probably damaging Het
Adgrf3 G A 5: 30,199,484 P318L possibly damaging Het
Ahcyl1 A T 3: 107,672,082 I212N probably damaging Het
Allc A T 12: 28,570,654 F33I probably damaging Het
Arhgap32 A G 9: 32,116,154 T7A probably benign Het
Bbs4 A G 9: 59,353,408 probably null Het
Btbd1 G T 7: 81,829,333 P20H unknown Het
Cass4 A G 2: 172,427,428 I477V possibly damaging Het
Cep83 A G 10: 94,750,322 E362G probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cntnap5b A G 1: 100,484,622 D896G probably benign Het
Crocc2 T C 1: 93,189,707 V305A probably benign Het
Cse1l G A 2: 166,934,753 V495I probably benign Het
Ctsj A T 13: 61,004,443 Y36* probably null Het
Ctss T G 3: 95,546,798 D220E probably benign Het
Ctu1 T C 7: 43,675,476 L113P probably benign Het
Cyp2d40 G A 15: 82,764,073 A13V possibly damaging Het
Dhrs4 A T 14: 55,478,762 probably benign Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dpysl5 C A 5: 30,778,055 Y167* probably null Het
E4f1 C T 17: 24,447,122 G234D probably damaging Het
Eif3g G T 9: 20,898,155 T27N probably benign Het
Eif3g T A 9: 20,898,156 T27S probably benign Het
Fcrls A G 3: 87,256,794 F343L possibly damaging Het
Fdft1 T C 14: 63,159,148 probably null Het
Gm4450 T C 3: 98,446,467 S239G probably benign Het
Gm960 T C 19: 4,627,246 H612R probably benign Het
Igf2r G T 17: 12,698,328 Q1562K probably benign Het
Ilf3 G A 9: 21,394,237 V232I probably benign Het
Irx5 C T 8: 92,360,631 T397M possibly damaging Het
Kif16b A T 2: 142,849,907 V219D probably damaging Het
Klkb1 T C 8: 45,277,015 I276M probably benign Het
Large2 A G 2: 92,369,921 L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 D61G probably benign Het
Map7 A G 10: 20,229,896 Y31C possibly damaging Het
Moxd2 T A 6: 40,880,441 I462F probably benign Het
Olfr1158 G A 2: 87,990,831 C240Y probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1450 T A 19: 12,954,013 C141* probably null Het
Phf20l1 T C 15: 66,632,820 V770A possibly damaging Het
Ppfia4 G A 1: 134,313,148 A819V probably damaging Het
Qrfpr A G 3: 36,182,527 W242R probably damaging Het
Rgs3 A G 4: 62,605,492 I53M probably benign Het
Rif1 T C 2: 52,081,299 F263S probably damaging Het
Rpl22l1 T C 3: 28,806,594 probably null Het
Ryr3 T A 2: 112,730,414 I3001F probably benign Het
Safb2 A G 17: 56,566,900 I675T probably damaging Het
Sec16b C T 1: 157,564,765 S901L probably damaging Het
Slc40a1 A T 1: 45,909,512 M536K probably damaging Het
Slfn3 T C 11: 83,212,999 V232A probably benign Het
Spata31d1b T C 13: 59,716,966 S643P probably benign Het
Tbc1d23 T C 16: 57,198,744 D251G probably benign Het
Tbccd1 T C 16: 22,822,499 E376G possibly damaging Het
Tmem184a G T 5: 139,805,730 P368T probably benign Het
Top1mt T C 15: 75,667,460 D362G probably damaging Het
Ugt3a2 C A 15: 9,370,123 P451H probably damaging Het
Unc80 G A 1: 66,638,062 C2050Y possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r179 T C 7: 23,928,777 V131A probably damaging Het
Wdr89 A G 12: 75,633,150 F110S probably damaging Het
Znrf3 T C 11: 5,282,379 Y282C probably damaging Het
Zscan18 T C 7: 12,769,370 D754G possibly damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R7986:Setd5 UTSW 6 113128457 missense probably benign 0.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8271:Setd5 UTSW 6 113115070 missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
R8801:Setd5 UTSW 6 113150892 missense possibly damaging 0.95
R8864:Setd5 UTSW 6 113111508 missense probably damaging 1.00
R9227:Setd5 UTSW 6 113121794 missense possibly damaging 0.92
R9588:Setd5 UTSW 6 113144064 missense probably damaging 1.00
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Z1191:Setd5 UTSW 6 113114996 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCTCGGAAGCACAGAATTTAG -3'
(R):5'- TCAAACATGTGCCTAGACAGTTTAG -3'

Sequencing Primer
(F):5'- TTTAGATGAAAATACCACTGAGGGC -3'
(R):5'- CCTGATTTTGAACAGAGATTATCAGC -3'
Posted On 2022-07-18