Incidental Mutation 'R9522:Vmn1r179'
ID 718950
Institutional Source Beutler Lab
Gene Symbol Vmn1r179
Ensembl Gene ENSMUSG00000046924
Gene Name vomeronasal 1 receptor 179
Synonyms V1rd17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23928386-23929357 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23928777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000055372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049819]
AlphaFold Q8R2B4
Predicted Effect probably damaging
Transcript: ENSMUST00000049819
AA Change: V131A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055372
Gene: ENSMUSG00000046924
AA Change: V131A

DomainStartEndE-ValueType
Pfam:TAS2R 23 313 3.8e-13 PFAM
Pfam:7tm_1 45 304 2e-8 PFAM
Pfam:V1R 57 312 4.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,466,123 S5C probably damaging Het
5830411N06Rik T A 7: 140,274,074 I330N possibly damaging Het
Abca14 A T 7: 120,248,145 Y744F probably null Het
Adam17 C A 12: 21,345,692 V277F probably damaging Het
Adcy8 C T 15: 64,920,711 C132Y probably damaging Het
Adgrf3 G A 5: 30,199,484 P318L possibly damaging Het
Ahcyl1 A T 3: 107,672,082 I212N probably damaging Het
Allc A T 12: 28,570,654 F33I probably damaging Het
Arhgap32 A G 9: 32,116,154 T7A probably benign Het
Bbs4 A G 9: 59,353,408 probably null Het
Btbd1 G T 7: 81,829,333 P20H unknown Het
Cass4 A G 2: 172,427,428 I477V possibly damaging Het
Cep83 A G 10: 94,750,322 E362G probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cntnap5b A G 1: 100,484,622 D896G probably benign Het
Crocc2 T C 1: 93,189,707 V305A probably benign Het
Cse1l G A 2: 166,934,753 V495I probably benign Het
Ctsj A T 13: 61,004,443 Y36* probably null Het
Ctss T G 3: 95,546,798 D220E probably benign Het
Ctu1 T C 7: 43,675,476 L113P probably benign Het
Cyp2d40 G A 15: 82,764,073 A13V possibly damaging Het
Dhrs4 A T 14: 55,478,762 probably benign Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dpysl5 C A 5: 30,778,055 Y167* probably null Het
E4f1 C T 17: 24,447,122 G234D probably damaging Het
Eif3g G T 9: 20,898,155 T27N probably benign Het
Eif3g T A 9: 20,898,156 T27S probably benign Het
Fcrls A G 3: 87,256,794 F343L possibly damaging Het
Fdft1 T C 14: 63,159,148 probably null Het
Gm4450 T C 3: 98,446,467 S239G probably benign Het
Gm960 T C 19: 4,627,246 H612R probably benign Het
Igf2r G T 17: 12,698,328 Q1562K probably benign Het
Ilf3 G A 9: 21,394,237 V232I probably benign Het
Irx5 C T 8: 92,360,631 T397M possibly damaging Het
Kif16b A T 2: 142,849,907 V219D probably damaging Het
Klkb1 T C 8: 45,277,015 I276M probably benign Het
Large2 A G 2: 92,369,921 L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 D61G probably benign Het
Map7 A G 10: 20,229,896 Y31C possibly damaging Het
Moxd2 T A 6: 40,880,441 I462F probably benign Het
Olfr1158 G A 2: 87,990,831 C240Y probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1450 T A 19: 12,954,013 C141* probably null Het
Phf20l1 T C 15: 66,632,820 V770A possibly damaging Het
Ppfia4 G A 1: 134,313,148 A819V probably damaging Het
Qrfpr A G 3: 36,182,527 W242R probably damaging Het
Rgs3 A G 4: 62,605,492 I53M probably benign Het
Rif1 T C 2: 52,081,299 F263S probably damaging Het
Rpl22l1 T C 3: 28,806,594 probably null Het
Ryr3 T A 2: 112,730,414 I3001F probably benign Het
Safb2 A G 17: 56,566,900 I675T probably damaging Het
Sec16b C T 1: 157,564,765 S901L probably damaging Het
Setd5 T G 6: 113,115,034 I272S probably damaging Het
Slc40a1 A T 1: 45,909,512 M536K probably damaging Het
Slfn3 T C 11: 83,212,999 V232A probably benign Het
Spata31d1b T C 13: 59,716,966 S643P probably benign Het
Tbc1d23 T C 16: 57,198,744 D251G probably benign Het
Tbccd1 T C 16: 22,822,499 E376G possibly damaging Het
Tmem184a G T 5: 139,805,730 P368T probably benign Het
Top1mt T C 15: 75,667,460 D362G probably damaging Het
Ugt3a2 C A 15: 9,370,123 P451H probably damaging Het
Unc80 G A 1: 66,638,062 C2050Y possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Wdr89 A G 12: 75,633,150 F110S probably damaging Het
Znrf3 T C 11: 5,282,379 Y282C probably damaging Het
Zscan18 T C 7: 12,769,370 D754G possibly damaging Het
Other mutations in Vmn1r179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Vmn1r179 APN 7 23929205 missense probably benign 0.00
R0029:Vmn1r179 UTSW 7 23929205 missense probably benign 0.00
R0029:Vmn1r179 UTSW 7 23929205 missense probably benign 0.00
R0058:Vmn1r179 UTSW 7 23929167 missense possibly damaging 0.88
R0470:Vmn1r179 UTSW 7 23928393 missense probably benign 0.00
R1451:Vmn1r179 UTSW 7 23928850 nonsense probably null
R4923:Vmn1r179 UTSW 7 23929066 missense possibly damaging 0.79
R4953:Vmn1r179 UTSW 7 23929090 missense probably damaging 0.99
R5248:Vmn1r179 UTSW 7 23929053 missense probably damaging 0.99
R5304:Vmn1r179 UTSW 7 23928675 missense probably benign 0.02
R5434:Vmn1r179 UTSW 7 23928962 missense probably benign 0.21
R6341:Vmn1r179 UTSW 7 23929066 missense possibly damaging 0.79
R6451:Vmn1r179 UTSW 7 23928651 missense possibly damaging 0.94
R6501:Vmn1r179 UTSW 7 23928917 missense probably benign 0.25
R7107:Vmn1r179 UTSW 7 23928394 nonsense probably null
R7480:Vmn1r179 UTSW 7 23929133 nonsense probably null
R8185:Vmn1r179 UTSW 7 23928738 missense possibly damaging 0.89
R8245:Vmn1r179 UTSW 7 23928971 missense possibly damaging 0.54
R8255:Vmn1r179 UTSW 7 23929011 missense probably benign 0.21
R8413:Vmn1r179 UTSW 7 23928852 missense probably benign 0.20
R9031:Vmn1r179 UTSW 7 23928809 missense probably benign 0.01
X0061:Vmn1r179 UTSW 7 23928394 nonsense probably null
Z1088:Vmn1r179 UTSW 7 23928482 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AACAGAGTCCCAGACAGGTG -3'
(R):5'- TCCAAAAGTGAAGCAGAACAACTTG -3'

Sequencing Primer
(F):5'- GTCCCAGACAGGTGATTTTAAGCC -3'
(R):5'- GAACAACTTGCTTCTACAGTCAGTG -3'
Posted On 2022-07-18