Incidental Mutation 'R9522:5830411N06Rik'
ID 718954
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140274074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 330 (I330N)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably benign
Transcript: ENSMUST00000093984
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164583
AA Change: I330N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: I330N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,466,123 S5C probably damaging Het
Abca14 A T 7: 120,248,145 Y744F probably null Het
Adam17 C A 12: 21,345,692 V277F probably damaging Het
Adcy8 C T 15: 64,920,711 C132Y probably damaging Het
Adgrf3 G A 5: 30,199,484 P318L possibly damaging Het
Ahcyl1 A T 3: 107,672,082 I212N probably damaging Het
Allc A T 12: 28,570,654 F33I probably damaging Het
Arhgap32 A G 9: 32,116,154 T7A probably benign Het
Bbs4 A G 9: 59,353,408 probably null Het
Btbd1 G T 7: 81,829,333 P20H unknown Het
Cass4 A G 2: 172,427,428 I477V possibly damaging Het
Cep83 A G 10: 94,750,322 E362G probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cntnap5b A G 1: 100,484,622 D896G probably benign Het
Crocc2 T C 1: 93,189,707 V305A probably benign Het
Cse1l G A 2: 166,934,753 V495I probably benign Het
Ctsj A T 13: 61,004,443 Y36* probably null Het
Ctss T G 3: 95,546,798 D220E probably benign Het
Ctu1 T C 7: 43,675,476 L113P probably benign Het
Cyp2d40 G A 15: 82,764,073 A13V possibly damaging Het
Dhrs4 A T 14: 55,478,762 probably benign Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dpysl5 C A 5: 30,778,055 Y167* probably null Het
E4f1 C T 17: 24,447,122 G234D probably damaging Het
Eif3g G T 9: 20,898,155 T27N probably benign Het
Eif3g T A 9: 20,898,156 T27S probably benign Het
Fcrls A G 3: 87,256,794 F343L possibly damaging Het
Fdft1 T C 14: 63,159,148 probably null Het
Gm4450 T C 3: 98,446,467 S239G probably benign Het
Gm960 T C 19: 4,627,246 H612R probably benign Het
Igf2r G T 17: 12,698,328 Q1562K probably benign Het
Ilf3 G A 9: 21,394,237 V232I probably benign Het
Irx5 C T 8: 92,360,631 T397M possibly damaging Het
Kif16b A T 2: 142,849,907 V219D probably damaging Het
Klkb1 T C 8: 45,277,015 I276M probably benign Het
Large2 A G 2: 92,369,921 L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 D61G probably benign Het
Map7 A G 10: 20,229,896 Y31C possibly damaging Het
Moxd2 T A 6: 40,880,441 I462F probably benign Het
Olfr1158 G A 2: 87,990,831 C240Y probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1450 T A 19: 12,954,013 C141* probably null Het
Phf20l1 T C 15: 66,632,820 V770A possibly damaging Het
Ppfia4 G A 1: 134,313,148 A819V probably damaging Het
Qrfpr A G 3: 36,182,527 W242R probably damaging Het
Rgs3 A G 4: 62,605,492 I53M probably benign Het
Rif1 T C 2: 52,081,299 F263S probably damaging Het
Rpl22l1 T C 3: 28,806,594 probably null Het
Ryr3 T A 2: 112,730,414 I3001F probably benign Het
Safb2 A G 17: 56,566,900 I675T probably damaging Het
Sec16b C T 1: 157,564,765 S901L probably damaging Het
Setd5 T G 6: 113,115,034 I272S probably damaging Het
Slc40a1 A T 1: 45,909,512 M536K probably damaging Het
Slfn3 T C 11: 83,212,999 V232A probably benign Het
Spata31d1b T C 13: 59,716,966 S643P probably benign Het
Tbc1d23 T C 16: 57,198,744 D251G probably benign Het
Tbccd1 T C 16: 22,822,499 E376G possibly damaging Het
Tmem184a G T 5: 139,805,730 P368T probably benign Het
Top1mt T C 15: 75,667,460 D362G probably damaging Het
Ugt3a2 C A 15: 9,370,123 P451H probably damaging Het
Unc80 G A 1: 66,638,062 C2050Y possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r179 T C 7: 23,928,777 V131A probably damaging Het
Wdr89 A G 12: 75,633,150 F110S probably damaging Het
Znrf3 T C 11: 5,282,379 Y282C probably damaging Het
Zscan18 T C 7: 12,769,370 D754G possibly damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAACAAGTCAGGCTGGC -3'
(R):5'- TGGCGACAACCGTGATGAAC -3'

Sequencing Primer
(F):5'- AGAGGTGCCAGTCCATGTG -3'
(R):5'- CGTGATGAACAGAGAAGATTCTATTG -3'
Posted On 2022-07-18