Incidental Mutation 'R9522:Tbccd1'
ID 718979
Institutional Source Beutler Lab
Gene Symbol Tbccd1
Ensembl Gene ENSMUSG00000004462
Gene Name TBCC domain containing 1
Synonyms 5730478M09Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9522 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 22631964-22676419 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22641249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 376 (E376G)
Ref Sequence ENSEMBL: ENSMUSP00000004576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004576] [ENSMUST00000232075] [ENSMUST00000232251] [ENSMUST00000232345]
AlphaFold Q640P7
Predicted Effect possibly damaging
Transcript: ENSMUST00000004576
AA Change: E376G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004576
Gene: ENSMUSG00000004462
AA Change: E376G

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
low complexity region 144 160 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
CARP 337 374 5.55e-5 SMART
CARP 375 409 8.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231229
Predicted Effect possibly damaging
Transcript: ENSMUST00000232075
AA Change: E376G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000232251
Predicted Effect probably benign
Transcript: ENSMUST00000232345
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,847,368 (GRCm39) Y744F probably null Het
Adam17 C A 12: 21,395,693 (GRCm39) V277F probably damaging Het
Adcy8 C T 15: 64,792,560 (GRCm39) C132Y probably damaging Het
Adgrf3 G A 5: 30,404,482 (GRCm39) P318L possibly damaging Het
Ahcyl1 A T 3: 107,579,398 (GRCm39) I212N probably damaging Het
Allc A T 12: 28,620,653 (GRCm39) F33I probably damaging Het
Arhgap32 A G 9: 32,027,450 (GRCm39) T7A probably benign Het
Bbs4 A G 9: 59,260,691 (GRCm39) probably null Het
Btbd1 G T 7: 81,479,081 (GRCm39) P20H unknown Het
Cass4 A G 2: 172,269,348 (GRCm39) I477V possibly damaging Het
Cep83 A G 10: 94,586,184 (GRCm39) E362G probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Cimip2c A T 5: 30,623,467 (GRCm39) S5C probably damaging Het
Cntnap5b A G 1: 100,412,347 (GRCm39) D896G probably benign Het
Crocc2 T C 1: 93,117,429 (GRCm39) V305A probably benign Het
Cse1l G A 2: 166,776,673 (GRCm39) V495I probably benign Het
Ctsj A T 13: 61,152,257 (GRCm39) Y36* probably null Het
Ctss T G 3: 95,454,109 (GRCm39) D220E probably benign Het
Ctu1 T C 7: 43,324,900 (GRCm39) L113P probably benign Het
Cyp2d40 G A 15: 82,648,274 (GRCm39) A13V possibly damaging Het
Dhrs4 A T 14: 55,716,219 (GRCm39) probably benign Het
Dlgap4 G T 2: 156,546,514 (GRCm39) R394L possibly damaging Het
Dpysl5 C A 5: 30,935,399 (GRCm39) Y167* probably null Het
E4f1 C T 17: 24,666,096 (GRCm39) G234D probably damaging Het
Eif3g G T 9: 20,809,451 (GRCm39) T27N probably benign Het
Eif3g T A 9: 20,809,452 (GRCm39) T27S probably benign Het
Fcrl2 A G 3: 87,164,101 (GRCm39) F343L possibly damaging Het
Fdft1 T C 14: 63,396,597 (GRCm39) probably null Het
Hsd3b9 T C 3: 98,353,783 (GRCm39) S239G probably benign Het
Igf2r G T 17: 12,917,215 (GRCm39) Q1562K probably benign Het
Ilf3 G A 9: 21,305,533 (GRCm39) V232I probably benign Het
Irx5 C T 8: 93,087,259 (GRCm39) T397M possibly damaging Het
Kif16b A T 2: 142,691,827 (GRCm39) V219D probably damaging Het
Klkb1 T C 8: 45,730,052 (GRCm39) I276M probably benign Het
Large2 A G 2: 92,200,266 (GRCm39) L115P probably damaging Het
Lrrc3b T C 14: 15,358,423 (GRCm38) D61G probably benign Het
Map7 A G 10: 20,105,642 (GRCm39) Y31C possibly damaging Het
Moxd2 T A 6: 40,857,375 (GRCm39) I462F probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or5b98 T A 19: 12,931,377 (GRCm39) C141* probably null Het
Or9m2 G A 2: 87,821,175 (GRCm39) C240Y probably damaging Het
Phf20l1 T C 15: 66,504,669 (GRCm39) V770A possibly damaging Het
Ppfia4 G A 1: 134,240,886 (GRCm39) A819V probably damaging Het
Qrfpr A G 3: 36,236,676 (GRCm39) W242R probably damaging Het
Rgs3 A G 4: 62,523,729 (GRCm39) I53M probably benign Het
Rif1 T C 2: 51,971,311 (GRCm39) F263S probably damaging Het
Rpl22l1 T C 3: 28,860,743 (GRCm39) probably null Het
Ryr3 T A 2: 112,560,759 (GRCm39) I3001F probably benign Het
Safb2 A G 17: 56,873,900 (GRCm39) I675T probably damaging Het
Scart2 T A 7: 139,853,987 (GRCm39) I330N possibly damaging Het
Sec16b C T 1: 157,392,335 (GRCm39) S901L probably damaging Het
Setd5 T G 6: 113,091,995 (GRCm39) I272S probably damaging Het
Slc40a1 A T 1: 45,948,672 (GRCm39) M536K probably damaging Het
Slfn3 T C 11: 83,103,825 (GRCm39) V232A probably benign Het
Spata31d1b T C 13: 59,864,780 (GRCm39) S643P probably benign Het
Tbc1d23 T C 16: 57,019,107 (GRCm39) D251G probably benign Het
Tmem184a G T 5: 139,791,485 (GRCm39) P368T probably benign Het
Top1mt T C 15: 75,539,309 (GRCm39) D362G probably damaging Het
Top6bl T C 19: 4,677,274 (GRCm39) H612R probably benign Het
Ugt3a1 C A 15: 9,370,209 (GRCm39) P451H probably damaging Het
Unc80 G A 1: 66,677,221 (GRCm39) C2050Y possibly damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vmn1r179 T C 7: 23,628,202 (GRCm39) V131A probably damaging Het
Wdr89 A G 12: 75,679,924 (GRCm39) F110S probably damaging Het
Znrf3 T C 11: 5,232,379 (GRCm39) Y282C probably damaging Het
Zscan18 T C 7: 12,503,297 (GRCm39) D754G possibly damaging Het
Other mutations in Tbccd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tbccd1 APN 16 22,641,294 (GRCm39) missense possibly damaging 0.81
PIT4243001:Tbccd1 UTSW 16 22,641,087 (GRCm39) missense probably damaging 1.00
PIT4402001:Tbccd1 UTSW 16 22,640,873 (GRCm39) missense probably damaging 1.00
R0055:Tbccd1 UTSW 16 22,660,655 (GRCm39) missense probably damaging 1.00
R0092:Tbccd1 UTSW 16 22,644,844 (GRCm39) missense possibly damaging 0.84
R0894:Tbccd1 UTSW 16 22,640,995 (GRCm39) missense probably benign 0.27
R1183:Tbccd1 UTSW 16 22,660,519 (GRCm39) missense probably benign 0.01
R1795:Tbccd1 UTSW 16 22,640,995 (GRCm39) missense probably benign 0.27
R1813:Tbccd1 UTSW 16 22,641,271 (GRCm39) missense probably benign
R2049:Tbccd1 UTSW 16 22,637,291 (GRCm39) splice site probably null
R2131:Tbccd1 UTSW 16 22,660,739 (GRCm39) missense probably benign 0.00
R3964:Tbccd1 UTSW 16 22,660,523 (GRCm39) missense probably damaging 1.00
R4201:Tbccd1 UTSW 16 22,644,698 (GRCm39) missense probably damaging 0.96
R4602:Tbccd1 UTSW 16 22,637,285 (GRCm39) splice site probably null
R4921:Tbccd1 UTSW 16 22,660,649 (GRCm39) missense probably benign 0.02
R6493:Tbccd1 UTSW 16 22,641,216 (GRCm39) missense probably damaging 1.00
R6554:Tbccd1 UTSW 16 22,640,874 (GRCm39) missense probably damaging 0.99
R6663:Tbccd1 UTSW 16 22,652,778 (GRCm39) frame shift probably null
R7220:Tbccd1 UTSW 16 22,652,747 (GRCm39) missense probably benign 0.21
R7431:Tbccd1 UTSW 16 22,644,563 (GRCm39) missense probably benign 0.03
R8090:Tbccd1 UTSW 16 22,660,805 (GRCm39) missense probably benign 0.00
R8186:Tbccd1 UTSW 16 22,637,189 (GRCm39) missense probably damaging 1.00
R8315:Tbccd1 UTSW 16 22,641,564 (GRCm39) missense probably damaging 1.00
R8545:Tbccd1 UTSW 16 22,652,779 (GRCm39) missense probably benign 0.09
R8688:Tbccd1 UTSW 16 22,641,208 (GRCm39) missense possibly damaging 0.54
R9775:Tbccd1 UTSW 16 22,652,666 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGGCACTGTAGCAAGG -3'
(R):5'- CTTACGGTAAGCGTAGGTCC -3'

Sequencing Primer
(F):5'- ACTGTAGCAAGGCCAGTCCTG -3'
(R):5'- GTAAGCGTAGGTCCCTAATATTTTG -3'
Posted On 2022-07-18