Incidental Mutation 'R9523:Nup210l'
ID 718997
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock # R9523 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90199866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1570 (P1570L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,539,191 T15A possibly damaging Het
2010315B03Rik G T 9: 124,294,022 Q91K Het
2210408I21Rik A G 13: 77,259,869 N419S possibly damaging Het
Abhd2 A G 7: 79,348,272 E184G probably damaging Het
Adgrg3 T C 8: 95,039,558 I339T probably benign Het
Adgrv1 C T 13: 81,419,059 A5332T Het
Akap13 T C 7: 75,643,445 V42A Het
Akap6 A G 12: 52,795,889 T7A probably benign Het
Apob A T 12: 8,002,069 D1170V probably damaging Het
Atad1 A G 19: 32,706,923 I25T possibly damaging Het
Atp4b G T 8: 13,386,746 N255K probably damaging Het
Atr C T 9: 95,910,557 A1644V possibly damaging Het
Bpnt1 T A 1: 185,345,387 C100S probably damaging Het
C1rl C T 6: 124,507,095 L203F probably benign Het
Clasp2 T A 9: 113,876,304 V576D probably damaging Het
Col8a2 A G 4: 126,311,480 T428A unknown Het
Copg2 T A 6: 30,749,506 probably null Het
Cpn2 C T 16: 30,259,941 R314H possibly damaging Het
Cpt2 G A 4: 107,907,157 A470V probably damaging Het
Cyp2a4 C T 7: 26,312,263 T303I probably damaging Het
Ddx42 A G 11: 106,241,780 D543G probably benign Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Fam219b T C 9: 57,537,636 F6L probably benign Het
Fsip2 G T 2: 82,977,628 L1430F probably damaging Het
Fstl4 A G 11: 53,184,639 I573V probably benign Het
Ggnbp2 A T 11: 84,854,362 S182R probably benign Het
Glud1 A G 14: 34,339,974 T484A probably benign Het
Gm19410 A G 8: 35,790,454 N682S probably benign Het
Gnao1 T C 8: 93,896,233 I55T Het
Hcn4 C T 9: 58,859,526 S790L unknown Het
Hist1h2bn G T 13: 21,754,135 A5S unknown Het
Ighv3-4 T C 12: 114,253,773 E66G probably damaging Het
Igkv6-23 A G 6: 70,260,542 S72P probably damaging Het
Kdm7a A C 6: 39,170,833 Y213D probably damaging Het
Klk15 T G 7: 43,938,346 M66R possibly damaging Het
Lce1d T A 3: 92,686,056 T17S unknown Het
Lipt1 T C 1: 37,875,453 Y197H probably damaging Het
Lrp1b A T 2: 41,770,966 D157E Het
Ltbp1 A G 17: 75,390,503 T1697A probably benign Het
March6 T C 15: 31,498,699 T151A probably benign Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Myo5b A G 18: 74,728,897 N1320S possibly damaging Het
Myt1l T A 12: 29,827,612 S421T unknown Het
Nav1 A T 1: 135,452,191 M1531K unknown Het
Nlrp4e A G 7: 23,355,211 D930G probably benign Het
Olfr1466 G T 19: 13,342,484 C242F probably damaging Het
Olfr1477 A T 19: 13,502,348 M2L probably benign Het
Olfr427 A T 1: 174,100,042 I195F probably damaging Het
Olfr575 A G 7: 102,955,257 S115P probably damaging Het
Olfr74 A T 2: 87,974,601 Y21* probably null Het
Olfr849 G A 9: 19,441,284 V124I possibly damaging Het
Oxct2b A T 4: 123,117,690 I468F probably damaging Het
Pcdhgb7 T A 18: 37,753,583 L602Q probably damaging Het
Prrc2c A G 1: 162,697,729 V1862A unknown Het
Rad54l2 C T 9: 106,695,952 R1110H probably damaging Het
Rere T A 4: 150,619,179 H180Q probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sfxn4 T C 19: 60,857,369 D63G probably damaging Het
Strn C T 17: 78,660,146 A579T probably benign Het
Stxbp3 A G 3: 108,840,440 L10P probably damaging Het
Swi5 T C 2: 32,280,727 M95V possibly damaging Het
Tln2 T C 9: 67,258,484 Y1027C probably damaging Het
Tmem65 A G 15: 58,790,153 probably null Het
Tox4 C T 14: 52,291,709 P376S probably benign Het
Tsg101 C T 7: 46,892,560 G215D possibly damaging Het
Utp18 A G 11: 93,878,007 S226P probably damaging Het
Vipr2 T C 12: 116,130,168 S174P probably damaging Het
Vmn2r24 G T 6: 123,786,991 V276F possibly damaging Het
Wdr26 T C 1: 181,186,055 R418G probably benign Het
Zfp235 T C 7: 24,140,956 Y267H probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATGCACCCACATTCCC -3'
(R):5'- AGGTATTTACTACTAAGCATAGCCA -3'

Sequencing Primer
(F):5'- CTGAGGACAGCTACAGTGTACTTAC -3'
(R):5'- CTGTGGAGAAACTCCTTACC -3'
Posted On 2022-07-18