Incidental Mutation 'R9524:Dpp10'
ID 719060
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9524 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123336882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 737 (Q737R)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: Q726R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: Q726R

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: Q737R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: Q737R

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,289,768 probably null Het
Adra2c G A 5: 35,280,799 R305Q probably benign Het
Ahnak A G 19: 9,037,253 D147G Het
Arhgap30 T A 1: 171,397,546 S57T probably damaging Het
Aspm T C 1: 139,480,869 I2498T probably damaging Het
Atr C T 9: 95,910,557 A1644V possibly damaging Het
Cc2d1a G T 8: 84,144,115 D101E probably benign Het
Cntfr A G 4: 41,661,995 L249P probably damaging Het
D130043K22Rik T C 13: 24,887,893 I940T possibly damaging Het
Dnah12 T G 14: 26,850,537 C2862G probably null Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dnah9 A G 11: 66,085,483 F1247L possibly damaging Het
Dpp3 A G 19: 4,909,869 V673A possibly damaging Het
Eif2a A T 3: 58,541,046 K100I possibly damaging Het
Fam35a G A 14: 34,249,288 Q547* probably null Het
Flnc C A 6: 29,461,110 N2694K probably damaging Het
Fv1 T A 4: 147,869,311 D111E possibly damaging Het
Gcnt3 G A 9: 70,034,287 A333V probably damaging Het
Gpr151 T C 18: 42,579,645 probably benign Het
Gxylt2 A G 6: 100,750,455 T177A probably benign Het
Hnmt G A 2: 24,003,868 L205F possibly damaging Het
Ikbkb A T 8: 22,682,724 probably null Het
Ikzf2 T C 1: 69,539,178 S391G probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kif3b A T 2: 153,317,540 K420N probably benign Het
Kmt2a A G 9: 44,818,997 V3341A unknown Het
Lce1i T C 3: 92,777,774 K32E unknown Het
Lmf1 A G 17: 25,662,540 Y521C probably damaging Het
Mki67 C T 7: 135,704,184 C655Y probably damaging Het
Morc3 T A 16: 93,870,513 V593E probably benign Het
Muc16 A G 9: 18,586,018 F6613L probably benign Het
Naip1 G A 13: 100,426,593 T688I probably benign Het
Olfr136 T A 17: 38,335,649 L164* probably null Het
Otop2 T A 11: 115,323,677 C87S probably benign Het
Picalm T A 7: 90,161,276 L97* probably null Het
Pik3c2g T A 6: 139,629,770 W272R probably damaging Het
Plekhg4 G A 8: 105,374,766 G20R unknown Het
Ppp1r35 G A 5: 137,779,042 A17T unknown Het
Ppp2r5e A T 12: 75,462,393 Y371N possibly damaging Het
Rexo1 T C 10: 80,551,038 E62G probably damaging Het
Rtl1 T C 12: 109,590,539 E1622G probably damaging Het
Ryr1 T C 7: 29,024,175 E4181G probably damaging Het
Saxo1 C A 4: 86,478,895 M135I probably benign Het
Shank2 C A 7: 144,410,446 P597Q possibly damaging Het
Slc44a1 G A 4: 53,542,389 V308I probably benign Het
Slc6a21 A G 7: 45,288,361 H367R probably benign Het
Snx11 G T 11: 96,769,197 T222K probably benign Het
Snx4 C T 16: 33,291,858 Q388* probably null Het
Sulf1 T C 1: 12,848,398 L831P probably damaging Het
Ugt2a3 A T 5: 87,337,159 V2D Het
Unc5c T C 3: 141,788,922 V406A possibly damaging Het
Unc5d A C 8: 28,875,611 N115K probably damaging Het
Usp28 C A 9: 49,035,726 T819N probably damaging Het
Usp42 T C 5: 143,716,949 D639G possibly damaging Het
Vmn2r102 T A 17: 19,677,302 M193K possibly damaging Het
Vmn2r12 A G 5: 109,091,957 Y247H probably damaging Het
Vps13d T C 4: 145,096,244 D2989G Het
Vsig2 A G 9: 37,544,039 E295G probably benign Het
Wdfy3 T A 5: 101,907,467 N1579I probably benign Het
Zfp521 T C 18: 13,847,116 D80G possibly damaging Het
Zfp663 A C 2: 165,353,687 L204R probably damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTCATGCACATGTGAGTG -3'
(R):5'- TGGCACTTGGCAGATCTCTAG -3'

Sequencing Primer
(F):5'- GTATGATACTTCCTTGCCACAGAGG -3'
(R):5'- GGCAGATCTCTAGTTAGAATCACCAG -3'
Posted On 2022-07-18