Incidental Mutation 'R9524:Pik3c2g'
ID 719082
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R9524 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 139587221-139969284 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139629770 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 272 (W272R)
Ref Sequence ENSEMBL: ENSMUSP00000141141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000190962]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032353
AA Change: W272R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185968
AA Change: W272R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000187618
AA Change: W272R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190962
AA Change: W272R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,289,768 probably null Het
Adra2c G A 5: 35,280,799 R305Q probably benign Het
Ahnak A G 19: 9,037,253 D147G Het
Arhgap30 T A 1: 171,397,546 S57T probably damaging Het
Aspm T C 1: 139,480,869 I2498T probably damaging Het
Atr C T 9: 95,910,557 A1644V possibly damaging Het
Cc2d1a G T 8: 84,144,115 D101E probably benign Het
Cntfr A G 4: 41,661,995 L249P probably damaging Het
D130043K22Rik T C 13: 24,887,893 I940T possibly damaging Het
Dnah12 T G 14: 26,850,537 C2862G probably null Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dnah9 A G 11: 66,085,483 F1247L possibly damaging Het
Dpp10 T C 1: 123,336,882 Q737R probably damaging Het
Dpp3 A G 19: 4,909,869 V673A possibly damaging Het
Eif2a A T 3: 58,541,046 K100I possibly damaging Het
Fam35a G A 14: 34,249,288 Q547* probably null Het
Flnc C A 6: 29,461,110 N2694K probably damaging Het
Fv1 T A 4: 147,869,311 D111E possibly damaging Het
Gcnt3 G A 9: 70,034,287 A333V probably damaging Het
Gpr151 T C 18: 42,579,645 probably benign Het
Gxylt2 A G 6: 100,750,455 T177A probably benign Het
Hnmt G A 2: 24,003,868 L205F possibly damaging Het
Ikbkb A T 8: 22,682,724 probably null Het
Ikzf2 T C 1: 69,539,178 S391G probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kif3b A T 2: 153,317,540 K420N probably benign Het
Kmt2a A G 9: 44,818,997 V3341A unknown Het
Lce1i T C 3: 92,777,774 K32E unknown Het
Lmf1 A G 17: 25,662,540 Y521C probably damaging Het
Mki67 C T 7: 135,704,184 C655Y probably damaging Het
Morc3 T A 16: 93,870,513 V593E probably benign Het
Muc16 A G 9: 18,586,018 F6613L probably benign Het
Naip1 G A 13: 100,426,593 T688I probably benign Het
Olfr136 T A 17: 38,335,649 L164* probably null Het
Otop2 T A 11: 115,323,677 C87S probably benign Het
Picalm T A 7: 90,161,276 L97* probably null Het
Plekhg4 G A 8: 105,374,766 G20R unknown Het
Ppp1r35 G A 5: 137,779,042 A17T unknown Het
Ppp2r5e A T 12: 75,462,393 Y371N possibly damaging Het
Rexo1 T C 10: 80,551,038 E62G probably damaging Het
Rtl1 T C 12: 109,590,539 E1622G probably damaging Het
Ryr1 T C 7: 29,024,175 E4181G probably damaging Het
Saxo1 C A 4: 86,478,895 M135I probably benign Het
Shank2 C A 7: 144,410,446 P597Q possibly damaging Het
Slc44a1 G A 4: 53,542,389 V308I probably benign Het
Slc6a21 A G 7: 45,288,361 H367R probably benign Het
Snx11 G T 11: 96,769,197 T222K probably benign Het
Snx4 C T 16: 33,291,858 Q388* probably null Het
Sulf1 T C 1: 12,848,398 L831P probably damaging Het
Ugt2a3 A T 5: 87,337,159 V2D Het
Unc5c T C 3: 141,788,922 V406A possibly damaging Het
Unc5d A C 8: 28,875,611 N115K probably damaging Het
Usp28 C A 9: 49,035,726 T819N probably damaging Het
Usp42 T C 5: 143,716,949 D639G possibly damaging Het
Vmn2r102 T A 17: 19,677,302 M193K possibly damaging Het
Vmn2r12 A G 5: 109,091,957 Y247H probably damaging Het
Vps13d T C 4: 145,096,244 D2989G Het
Vsig2 A G 9: 37,544,039 E295G probably benign Het
Wdfy3 T A 5: 101,907,467 N1579I probably benign Het
Zfp521 T C 18: 13,847,116 D80G possibly damaging Het
Zfp663 A C 2: 165,353,687 L204R probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
R8888:Pik3c2g UTSW 6 139730366 nonsense probably null
R8931:Pik3c2g UTSW 6 139875367 missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139622403 missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139875435 missense
R9383:Pik3c2g UTSW 6 139882016 nonsense probably null
R9531:Pik3c2g UTSW 6 139896200 missense
R9630:Pik3c2g UTSW 6 139622239 missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139967791 missense unknown
R9708:Pik3c2g UTSW 6 139629867 missense probably benign
R9717:Pik3c2g UTSW 6 139896184 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGTTCTCAGTTAGTGTTCC -3'
(R):5'- ACAGTGCCGAATGGTGGTTC -3'

Sequencing Primer
(F):5'- TCCCATGTTGCAGACAATGG -3'
(R):5'- CTTTTAGTGAGTTCAAGGCTATCC -3'
Posted On 2022-07-18