Incidental Mutation 'R9524:Pik3c2g'
ID 719082
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9524 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 139591070-139915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139606768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 272 (W272R)
Ref Sequence ENSEMBL: ENSMUSP00000141141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000190962]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032353
AA Change: W272R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185968
AA Change: W272R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000187618
AA Change: W272R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190962
AA Change: W272R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: W272R

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,180,594 (GRCm39) probably null Het
Adra2c G A 5: 35,438,143 (GRCm39) R305Q probably benign Het
Ahnak A G 19: 9,014,617 (GRCm39) D147G Het
Arhgap30 T A 1: 171,225,114 (GRCm39) S57T probably damaging Het
Aspm T C 1: 139,408,607 (GRCm39) I2498T probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
Cc2d1a G T 8: 84,870,744 (GRCm39) D101E probably benign Het
Cntfr A G 4: 41,661,995 (GRCm39) L249P probably damaging Het
D130043K22Rik T C 13: 25,071,876 (GRCm39) I940T possibly damaging Het
Dnah12 T G 14: 26,572,494 (GRCm39) C2862G probably null Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dnah9 A G 11: 65,976,309 (GRCm39) F1247L possibly damaging Het
Dpp10 T C 1: 123,264,611 (GRCm39) Q737R probably damaging Het
Dpp3 A G 19: 4,959,897 (GRCm39) V673A possibly damaging Het
Eif2a A T 3: 58,448,467 (GRCm39) K100I possibly damaging Het
Flnc C A 6: 29,461,109 (GRCm39) N2694K probably damaging Het
Fv1 T A 4: 147,953,768 (GRCm39) D111E possibly damaging Het
Gcnt3 G A 9: 69,941,569 (GRCm39) A333V probably damaging Het
Gpr151 T C 18: 42,712,710 (GRCm39) probably benign Het
Gxylt2 A G 6: 100,727,416 (GRCm39) T177A probably benign Het
Hnmt G A 2: 23,893,880 (GRCm39) L205F possibly damaging Het
Ikbkb A T 8: 23,172,740 (GRCm39) probably null Het
Ikzf2 T C 1: 69,578,337 (GRCm39) S391G probably benign Het
Kif26a C T 12: 112,140,286 (GRCm39) T505M probably damaging Het
Kif3b A T 2: 153,159,460 (GRCm39) K420N probably benign Het
Kmt2a A G 9: 44,730,294 (GRCm39) V3341A unknown Het
Lce1i T C 3: 92,685,081 (GRCm39) K32E unknown Het
Lmf1 A G 17: 25,881,514 (GRCm39) Y521C probably damaging Het
Mki67 C T 7: 135,305,913 (GRCm39) C655Y probably damaging Het
Morc3 T A 16: 93,667,401 (GRCm39) V593E probably benign Het
Muc16 A G 9: 18,497,314 (GRCm39) F6613L probably benign Het
Naip1 G A 13: 100,563,101 (GRCm39) T688I probably benign Het
Or2n1d T A 17: 38,646,540 (GRCm39) L164* probably null Het
Otop2 T A 11: 115,214,503 (GRCm39) C87S probably benign Het
Picalm T A 7: 89,810,484 (GRCm39) L97* probably null Het
Plekhg4 G A 8: 106,101,398 (GRCm39) G20R unknown Het
Ppp1r35 G A 5: 137,777,304 (GRCm39) A17T unknown Het
Ppp2r5e A T 12: 75,509,167 (GRCm39) Y371N possibly damaging Het
Rexo1 T C 10: 80,386,872 (GRCm39) E62G probably damaging Het
Rtl1 T C 12: 109,556,973 (GRCm39) E1622G probably damaging Het
Ryr1 T C 7: 28,723,600 (GRCm39) E4181G probably damaging Het
Saxo1 C A 4: 86,397,132 (GRCm39) M135I probably benign Het
Shank2 C A 7: 143,964,183 (GRCm39) P597Q possibly damaging Het
Shld2 G A 14: 33,971,245 (GRCm39) Q547* probably null Het
Slc44a1 G A 4: 53,542,389 (GRCm39) V308I probably benign Het
Slc6a21 A G 7: 44,937,785 (GRCm39) H367R probably benign Het
Snx11 G T 11: 96,660,023 (GRCm39) T222K probably benign Het
Snx4 C T 16: 33,112,228 (GRCm39) Q388* probably null Het
Sulf1 T C 1: 12,918,622 (GRCm39) L831P probably damaging Het
Ugt2a3 A T 5: 87,485,018 (GRCm39) V2D Het
Unc5c T C 3: 141,494,683 (GRCm39) V406A possibly damaging Het
Unc5d A C 8: 29,365,639 (GRCm39) N115K probably damaging Het
Usp28 C A 9: 48,947,026 (GRCm39) T819N probably damaging Het
Usp42 T C 5: 143,702,704 (GRCm39) D639G possibly damaging Het
Vmn2r102 T A 17: 19,897,564 (GRCm39) M193K possibly damaging Het
Vmn2r12 A G 5: 109,239,823 (GRCm39) Y247H probably damaging Het
Vps13d T C 4: 144,822,814 (GRCm39) D2989G Het
Vsig2 A G 9: 37,455,335 (GRCm39) E295G probably benign Het
Wdfy3 T A 5: 102,055,333 (GRCm39) N1579I probably benign Het
Zfp521 T C 18: 13,980,173 (GRCm39) D80G possibly damaging Het
Zfp663 A C 2: 165,195,607 (GRCm39) L204R probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139,841,851 (GRCm39) missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139,798,583 (GRCm39) missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01580:Pik3c2g APN 6 139,599,514 (GRCm39) missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01813:Pik3c2g APN 6 139,599,407 (GRCm39) missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139,806,081 (GRCm39) missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139,863,730 (GRCm39) missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139,798,526 (GRCm39) missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139,682,699 (GRCm39) missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139,913,554 (GRCm39) missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139,718,133 (GRCm39) critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4340:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4976:Pik3c2g UTSW 6 139,612,652 (GRCm39) frame shift probably null
IGL02837:Pik3c2g UTSW 6 139,603,562 (GRCm39) nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139,805,096 (GRCm39) missense
R0002:Pik3c2g UTSW 6 139,714,471 (GRCm39) missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139,903,519 (GRCm39) missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139,639,441 (GRCm39) missense unknown
R0719:Pik3c2g UTSW 6 139,606,723 (GRCm39) missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139,903,425 (GRCm39) splice site probably benign
R0840:Pik3c2g UTSW 6 139,841,798 (GRCm39) missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139,718,154 (GRCm39) missense probably benign
R1501:Pik3c2g UTSW 6 139,789,796 (GRCm39) critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139,693,904 (GRCm39) missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139,612,634 (GRCm39) intron probably benign
R1907:Pik3c2g UTSW 6 139,789,768 (GRCm39) missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139,846,112 (GRCm39) critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139,599,546 (GRCm39) missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139,801,012 (GRCm39) nonsense probably null
R2188:Pik3c2g UTSW 6 139,798,600 (GRCm39) missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139,801,018 (GRCm39) missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139,798,589 (GRCm39) missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139,612,608 (GRCm39) intron probably benign
R4108:Pik3c2g UTSW 6 139,676,096 (GRCm39) missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139,787,407 (GRCm39) intron probably benign
R4474:Pik3c2g UTSW 6 139,610,749 (GRCm39) missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139,665,732 (GRCm39) missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139,665,744 (GRCm39) missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139,714,505 (GRCm39) missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139,913,528 (GRCm39) missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139,841,928 (GRCm39) missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5072:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5073:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5074:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5107:Pik3c2g UTSW 6 139,612,623 (GRCm39) intron probably benign
R5186:Pik3c2g UTSW 6 139,599,016 (GRCm39) missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139,841,983 (GRCm39) critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139,599,121 (GRCm39) missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139,665,808 (GRCm39) missense probably benign
R5417:Pik3c2g UTSW 6 139,682,669 (GRCm39) missense probably benign
R5435:Pik3c2g UTSW 6 139,661,581 (GRCm39) splice site probably null
R5580:Pik3c2g UTSW 6 139,603,531 (GRCm39) missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139,682,733 (GRCm39) missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R5914:Pik3c2g UTSW 6 139,599,477 (GRCm39) missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139,842,518 (GRCm39) missense probably damaging 1.00
R6046:Pik3c2g UTSW 6 139,599,137 (GRCm39) missense probably damaging 0.96
R6298:Pik3c2g UTSW 6 139,603,561 (GRCm39) missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139,665,724 (GRCm39) missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139,676,195 (GRCm39) missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139,841,899 (GRCm39) missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139,903,502 (GRCm39) missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139,599,061 (GRCm39) missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139,606,868 (GRCm39) missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139,805,990 (GRCm39) missense
R7215:Pik3c2g UTSW 6 139,700,589 (GRCm39) missense
R7332:Pik3c2g UTSW 6 139,841,981 (GRCm39) missense
R7357:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139,913,620 (GRCm39) missense unknown
R7385:Pik3c2g UTSW 6 139,801,079 (GRCm39) missense
R7455:Pik3c2g UTSW 6 139,913,643 (GRCm39) missense unknown
R7651:Pik3c2g UTSW 6 139,599,070 (GRCm39) missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139,842,470 (GRCm39) missense
R7923:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139,827,786 (GRCm39) missense
R8005:Pik3c2g UTSW 6 139,599,067 (GRCm39) missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139,881,782 (GRCm39) missense unknown
R8724:Pik3c2g UTSW 6 139,913,619 (GRCm39) missense unknown
R8733:Pik3c2g UTSW 6 139,714,426 (GRCm39) nonsense probably null
R8809:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R8888:Pik3c2g UTSW 6 139,676,092 (GRCm39) nonsense probably null
R8931:Pik3c2g UTSW 6 139,821,093 (GRCm39) missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139,599,401 (GRCm39) missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139,821,161 (GRCm39) missense
R9383:Pik3c2g UTSW 6 139,827,742 (GRCm39) nonsense probably null
R9531:Pik3c2g UTSW 6 139,841,926 (GRCm39) missense
R9630:Pik3c2g UTSW 6 139,599,237 (GRCm39) missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139,913,517 (GRCm39) missense unknown
R9708:Pik3c2g UTSW 6 139,606,865 (GRCm39) missense probably benign
R9717:Pik3c2g UTSW 6 139,841,910 (GRCm39) missense
RF015:Pik3c2g UTSW 6 139,700,497 (GRCm39) missense
RF032:Pik3c2g UTSW 6 139,612,656 (GRCm39) frame shift probably null
X0024:Pik3c2g UTSW 6 139,805,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGTTCTCAGTTAGTGTTCC -3'
(R):5'- ACAGTGCCGAATGGTGGTTC -3'

Sequencing Primer
(F):5'- TCCCATGTTGCAGACAATGG -3'
(R):5'- CTTTTAGTGAGTTCAAGGCTATCC -3'
Posted On 2022-07-18