Incidental Mutation 'R9525:Flnb'
ID 719168
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9525 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7905481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1077 (V1077E)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: V1077E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V1077E

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,676,980 N201K Het
Adgrv1 C T 13: 81,445,334 G4178E possibly damaging Het
Alpk2 A G 18: 65,266,217 Y2097H probably damaging Het
Anapc2 T C 2: 25,276,327 S369P probably damaging Het
Atr C T 9: 95,910,557 A1644V possibly damaging Het
Camsap1 G A 2: 25,953,950 H230Y probably benign Het
Cbx7 A C 15: 79,930,596 W35G probably damaging Het
Cc2d2b T C 19: 40,784,986 Y498H probably damaging Het
Ccdc162 T A 10: 41,683,226 R126W probably damaging Het
Cd274 T A 19: 29,382,479 L228Q probably benign Het
Cfap57 A T 4: 118,576,581 I1000N probably damaging Het
Chadl C A 15: 81,694,019 G470C probably damaging Het
Clasp2 T C 9: 113,911,609 L1217P probably damaging Het
Crnkl1 A G 2: 145,928,278 V215A probably benign Het
Dbx2 G T 15: 95,654,423 H114N probably benign Het
Ddb2 T G 2: 91,234,835 T82P probably benign Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Epha1 A T 6: 42,367,824 M66K probably damaging Het
Fan1 A C 7: 64,372,259 probably null Het
Fgd2 T A 17: 29,364,981 L123Q probably damaging Het
Fnbp1l A T 3: 122,559,054 M251K probably damaging Het
Gal3st2c T A 1: 94,008,206 F93L probably damaging Het
Gdf2 T C 14: 33,945,607 *429Q probably null Het
Gdpd5 A G 7: 99,454,949 T455A possibly damaging Het
Gm11238 G A 4: 73,654,824 S100N probably benign Het
Gm13124 T A 4: 144,555,430 D264V possibly damaging Het
Gm4788 G T 1: 139,774,512 T78K probably damaging Het
Gm8356 G T 14: 6,535,192 Q109K Het
Gpr20 A T 15: 73,695,832 V236E probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Grin1 T C 2: 25,297,460 N613D probably damaging Het
Hepacam2 A G 6: 3,476,046 V293A probably benign Het
Hist1h2bn G T 13: 21,754,135 A5S unknown Het
Igf1r G A 7: 68,214,934 R1160Q probably damaging Het
Iqcd T C 5: 120,600,152 Y12H probably benign Het
Itih1 T C 14: 30,936,754 S393G probably benign Het
Klhl33 T C 14: 50,891,472 M507V probably null Het
Mast4 G T 13: 102,736,436 H2141Q probably benign Het
Mkrn2 T A 6: 115,610,525 D54E probably damaging Het
Mrm3 A G 11: 76,250,278 T371A possibly damaging Het
Mylk2 T A 2: 152,917,632 M414K probably damaging Het
Nlrp4b A G 7: 10,714,821 E317G probably damaging Het
Olfr1051 A G 2: 86,276,140 S116P probably benign Het
Olfr623 A T 7: 103,660,935 I105N probably damaging Het
Olfr641 A G 7: 104,040,613 I272M possibly damaging Het
Pcdhb18 T A 18: 37,491,834 V739E probably damaging Het
Pkhd1l1 A T 15: 44,584,926 T3834S possibly damaging Het
Pkp3 A G 7: 141,088,397 D546G probably damaging Het
Pot1a A T 6: 25,745,917 M595K probably benign Het
Pus7l A G 15: 94,540,883 I27T probably damaging Het
Rbp3 A G 14: 33,954,445 I117V probably benign Het
Rnf19a A T 15: 36,247,229 L454H probably damaging Het
Rps6kb1 C A 11: 86,519,920 K167N possibly damaging Het
Saxo1 A T 4: 86,444,949 Y432* probably null Het
Setdb2 A T 14: 59,409,392 V558E probably benign Het
Tbck T C 3: 132,751,205 F627L probably damaging Het
Tbpl2 T G 2: 24,096,535 M1L probably benign Het
Tcrg-V5 T C 13: 19,192,715 C111R probably damaging Het
Thegl A G 5: 77,047,291 N104S probably benign Het
Timp2 A C 11: 118,303,852 D170E probably benign Het
Tomm40 A G 7: 19,702,887 Y303H probably damaging Het
Trhr T C 15: 44,197,477 I131T possibly damaging Het
Vmn1r159 A G 7: 22,842,992 V205A probably damaging Het
Vmn2r25 G T 6: 123,823,205 T726K probably damaging Het
Wwox T A 8: 114,706,365 V257E probably benign Het
Xxylt1 A G 16: 31,050,775 I169T probably benign Het
Zfp457 T C 13: 67,293,428 Y361C probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9180:Flnb UTSW 14 7818219 missense probably damaging 1.00
R9189:Flnb UTSW 14 7892976 missense possibly damaging 0.90
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9484:Flnb UTSW 14 7929004 missense probably benign 0.06
R9505:Flnb UTSW 14 7904665 missense probably benign
R9621:Flnb UTSW 14 7926421 missense probably damaging 0.99
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GAAGCAAACTCGTGTGCGTG -3'
(R):5'- AGGGGTCAAACGGCATTTC -3'

Sequencing Primer
(F):5'- AGATACTGACATATGCTTTTGTGTGC -3'
(R):5'- GGGTCAAACGGCATTTCAATGTC -3'
Posted On 2022-07-18