Mutagenetix > Incidental Mutation

Incidental Mutation 'R9525:Setdb2'

719173

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R9525 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59409392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 558 (V558E)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably benign
Transcript: ENSMUST00000095775
AA Change: V574E

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: V574E

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: V558E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: V558E

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	T	5: 109,676,980	N201K		Het
Adgrv1	C	T	13: 81,445,334	G4178E	possibly damaging	Het
Alpk2	A	G	18: 65,266,217	Y2097H	probably damaging	Het
Anapc2	T	C	2: 25,276,327	S369P	probably damaging	Het
Atr	C	T	9: 95,910,557	A1644V	possibly damaging	Het
Camsap1	G	A	2: 25,953,950	H230Y	probably benign	Het
Cbx7	A	C	15: 79,930,596	W35G	probably damaging	Het
Cc2d2b	T	C	19: 40,784,986	Y498H	probably damaging	Het
Ccdc162	T	A	10: 41,683,226	R126W	probably damaging	Het
Cd274	T	A	19: 29,382,479	L228Q	probably benign	Het
Cfap57	A	T	4: 118,576,581	I1000N	probably damaging	Het
Chadl	C	A	15: 81,694,019	G470C	probably damaging	Het
Clasp2	T	C	9: 113,911,609	L1217P	probably damaging	Het
Crnkl1	A	G	2: 145,928,278	V215A	probably benign	Het
Dbx2	G	T	15: 95,654,423	H114N	probably benign	Het
Ddb2	T	G	2: 91,234,835	T82P	probably benign	Het
Emc8	T	C	8: 120,667,917	Y21C	probably damaging	Het
Epha1	A	T	6: 42,367,824	M66K	probably damaging	Het
Fan1	A	C	7: 64,372,259		probably null	Het
Fgd2	T	A	17: 29,364,981	L123Q	probably damaging	Het
Flnb	T	A	14: 7,905,481	V1077E	probably damaging	Het
Fnbp1l	A	T	3: 122,559,054	M251K	probably damaging	Het
Gal3st2c	T	A	1: 94,008,206	F93L	probably damaging	Het
Gdf2	T	C	14: 33,945,607	*429Q	probably null	Het
Gdpd5	A	G	7: 99,454,949	T455A	possibly damaging	Het
Gm11238	G	A	4: 73,654,824	S100N	probably benign	Het
Gm13124	T	A	4: 144,555,430	D264V	possibly damaging	Het
Gm4788	G	T	1: 139,774,512	T78K	probably damaging	Het
Gm8356	G	T	14: 6,535,192	Q109K		Het
Gpr20	A	T	15: 73,695,832	V236E	probably benign	Het
Gpr39	T	C	1: 125,872,586	V358A	probably damaging	Het
Grin1	T	C	2: 25,297,460	N613D	probably damaging	Het
Hepacam2	A	G	6: 3,476,046	V293A	probably benign	Het
Hist1h2bn	G	T	13: 21,754,135	A5S	unknown	Het
Igf1r	G	A	7: 68,214,934	R1160Q	probably damaging	Het
Iqcd	T	C	5: 120,600,152	Y12H	probably benign	Het
Itih1	T	C	14: 30,936,754	S393G	probably benign	Het
Klhl33	T	C	14: 50,891,472	M507V	probably null	Het
Mast4	G	T	13: 102,736,436	H2141Q	probably benign	Het
Mkrn2	T	A	6: 115,610,525	D54E	probably damaging	Het
Mrm3	A	G	11: 76,250,278	T371A	possibly damaging	Het
Mylk2	T	A	2: 152,917,632	M414K	probably damaging	Het
Nlrp4b	A	G	7: 10,714,821	E317G	probably damaging	Het
Olfr1051	A	G	2: 86,276,140	S116P	probably benign	Het
Olfr623	A	T	7: 103,660,935	I105N	probably damaging	Het
Olfr641	A	G	7: 104,040,613	I272M	possibly damaging	Het
Pcdhb18	T	A	18: 37,491,834	V739E	probably damaging	Het
Pkhd1l1	A	T	15: 44,584,926	T3834S	possibly damaging	Het
Pkp3	A	G	7: 141,088,397	D546G	probably damaging	Het
Pot1a	A	T	6: 25,745,917	M595K	probably benign	Het
Pus7l	A	G	15: 94,540,883	I27T	probably damaging	Het
Rbp3	A	G	14: 33,954,445	I117V	probably benign	Het
Rnf19a	A	T	15: 36,247,229	L454H	probably damaging	Het
Rps6kb1	C	A	11: 86,519,920	K167N	possibly damaging	Het
Saxo1	A	T	4: 86,444,949	Y432*	probably null	Het
Tbck	T	C	3: 132,751,205	F627L	probably damaging	Het
Tbpl2	T	G	2: 24,096,535	M1L	probably benign	Het
Tcrg-V5	T	C	13: 19,192,715	C111R	probably damaging	Het
Thegl	A	G	5: 77,047,291	N104S	probably benign	Het
Timp2	A	C	11: 118,303,852	D170E	probably benign	Het
Tomm40	A	G	7: 19,702,887	Y303H	probably damaging	Het
Trhr	T	C	15: 44,197,477	I131T	possibly damaging	Het
Vmn1r159	A	G	7: 22,842,992	V205A	probably damaging	Het
Vmn2r25	G	T	6: 123,823,205	T726K	probably damaging	Het
Wwox	T	A	8: 114,706,365	V257E	probably benign	Het
Xxylt1	A	G	16: 31,050,775	I169T	probably benign	Het
Zfp457	T	C	13: 67,293,428	Y361C	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAACGGCCCACATTTCCTTC -3'
(R):5'- GTCATCTCACTTAATCTTAGCACTG -3'

Sequencing Primer
(F):5'- TTTGAAGCATCCAATAGAAACAGAC -3'
(R):5'- CTTAATCTTAGCACTGTTACTTAGCC -3'

Posted On

2022-07-18