Incidental Mutation 'R9525:Setdb2'
ID 719173
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.572) question?
Stock # R9525 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59646841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 558 (V558E)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably benign
Transcript: ENSMUST00000095775
AA Change: V574E

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: V574E

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161459
AA Change: V558E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: V558E

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm2 T A 4: 144,282,000 (GRCm39) D264V possibly damaging Het
Adgrv1 C T 13: 81,593,453 (GRCm39) G4178E possibly damaging Het
Alpk2 A G 18: 65,399,288 (GRCm39) Y2097H probably damaging Het
Anapc2 T C 2: 25,166,339 (GRCm39) S369P probably damaging Het
Atr C T 9: 95,792,610 (GRCm39) A1644V possibly damaging Het
Camsap1 G A 2: 25,843,962 (GRCm39) H230Y probably benign Het
Cbx7 A C 15: 79,814,797 (GRCm39) W35G probably damaging Het
Cc2d2b T C 19: 40,773,430 (GRCm39) Y498H probably damaging Het
Ccdc162 T A 10: 41,559,222 (GRCm39) R126W probably damaging Het
Cd274 T A 19: 29,359,879 (GRCm39) L228Q probably benign Het
Cfap57 A T 4: 118,433,778 (GRCm39) I1000N probably damaging Het
Cfhr4 G T 1: 139,702,250 (GRCm39) T78K probably damaging Het
Chadl C A 15: 81,578,220 (GRCm39) G470C probably damaging Het
Clasp2 T C 9: 113,740,677 (GRCm39) L1217P probably damaging Het
Crnkl1 A G 2: 145,770,198 (GRCm39) V215A probably benign Het
Dbx2 G T 15: 95,552,304 (GRCm39) H114N probably benign Het
Ddb2 T G 2: 91,065,180 (GRCm39) T82P probably benign Het
Emc8 T C 8: 121,394,656 (GRCm39) Y21C probably damaging Het
Epha1 A T 6: 42,344,758 (GRCm39) M66K probably damaging Het
Fan1 A C 7: 64,022,007 (GRCm39) probably null Het
Fgd2 T A 17: 29,583,955 (GRCm39) L123Q probably damaging Het
Flnb T A 14: 7,905,481 (GRCm38) V1077E probably damaging Het
Fnbp1l A T 3: 122,352,703 (GRCm39) M251K probably damaging Het
Gal3st2c T A 1: 93,935,928 (GRCm39) F93L probably damaging Het
Gdf2 T C 14: 33,667,564 (GRCm39) *429Q probably null Het
Gdpd5 A G 7: 99,104,156 (GRCm39) T455A possibly damaging Het
Gm8356 G T 14: 17,691,339 (GRCm39) Q109K Het
Gpr20 A T 15: 73,567,681 (GRCm39) V236E probably benign Het
Gpr39 T C 1: 125,800,323 (GRCm39) V358A probably damaging Het
Grin1 T C 2: 25,187,472 (GRCm39) N613D probably damaging Het
H2bc15 G T 13: 21,938,305 (GRCm39) A5S unknown Het
Hepacam2 A G 6: 3,476,046 (GRCm39) V293A probably benign Het
Igf1r G A 7: 67,864,682 (GRCm39) R1160Q probably damaging Het
Iqcd T C 5: 120,738,217 (GRCm39) Y12H probably benign Het
Itih1 T C 14: 30,658,711 (GRCm39) S393G probably benign Het
Klhl33 T C 14: 51,128,929 (GRCm39) M507V probably null Het
Mast4 G T 13: 102,872,944 (GRCm39) H2141Q probably benign Het
Mkrn2 T A 6: 115,587,486 (GRCm39) D54E probably damaging Het
Mrm3 A G 11: 76,141,104 (GRCm39) T371A possibly damaging Het
Msantd5f3 G A 4: 73,573,061 (GRCm39) S100N probably benign Het
Mylk2 T A 2: 152,759,552 (GRCm39) M414K probably damaging Het
Nlrp4b A G 7: 10,448,748 (GRCm39) E317G probably damaging Het
Or51b6b A T 7: 103,310,142 (GRCm39) I105N probably damaging Het
Or51i2 A G 7: 103,689,820 (GRCm39) I272M possibly damaging Het
Or8k20 A G 2: 86,106,484 (GRCm39) S116P probably benign Het
Pcdhb18 T A 18: 37,624,887 (GRCm39) V739E probably damaging Het
Pkhd1l1 A T 15: 44,448,322 (GRCm39) T3834S possibly damaging Het
Pkp3 A G 7: 140,668,310 (GRCm39) D546G probably damaging Het
Pot1a A T 6: 25,745,916 (GRCm39) M595K probably benign Het
Pus7l A G 15: 94,438,764 (GRCm39) I27T probably damaging Het
Rbp3 A G 14: 33,676,402 (GRCm39) I117V probably benign Het
Rnf19a A T 15: 36,247,375 (GRCm39) L454H probably damaging Het
Rps6kb1 C A 11: 86,410,746 (GRCm39) K167N possibly damaging Het
Saxo1 A T 4: 86,363,186 (GRCm39) Y432* probably null Het
Spmap2l A G 5: 77,195,138 (GRCm39) N104S probably benign Het
Tbck T C 3: 132,456,966 (GRCm39) F627L probably damaging Het
Tbpl2 T G 2: 23,986,547 (GRCm39) M1L probably benign Het
Timp2 A C 11: 118,194,678 (GRCm39) D170E probably benign Het
Tomm40 A G 7: 19,436,812 (GRCm39) Y303H probably damaging Het
Trgv5 T C 13: 19,376,885 (GRCm39) C111R probably damaging Het
Trhr T C 15: 44,060,873 (GRCm39) I131T possibly damaging Het
Vmn1r159 A G 7: 22,542,417 (GRCm39) V205A probably damaging Het
Vmn2r25 G T 6: 123,800,164 (GRCm39) T726K probably damaging Het
Wwox T A 8: 115,433,105 (GRCm39) V257E probably benign Het
Xxylt1 A G 16: 30,869,593 (GRCm39) I169T probably benign Het
Zfp1007 A T 5: 109,824,846 (GRCm39) N201K Het
Zfp457 T C 13: 67,441,492 (GRCm39) Y361C probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACGGCCCACATTTCCTTC -3'
(R):5'- GTCATCTCACTTAATCTTAGCACTG -3'

Sequencing Primer
(F):5'- TTTGAAGCATCCAATAGAAACAGAC -3'
(R):5'- CTTAATCTTAGCACTGTTACTTAGCC -3'
Posted On 2022-07-18