Incidental Mutation 'R9526:Cntnap2'
ID 719218
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9526 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46015231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 364 (L364Q)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: L364Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: L364Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,609,098 Y372C probably damaging Het
4930412O13Rik A T 2: 9,882,823 T12S unknown Het
Actn1 A G 12: 80,183,619 L287S probably damaging Het
Adgrf1 A T 17: 43,305,346 Q292L possibly damaging Het
Arhgap32 A G 9: 32,260,730 D1602G probably benign Het
Atrnl1 C T 19: 57,629,119 P109S probably damaging Het
Camsap1 G A 2: 25,953,950 H230Y probably benign Het
Capns1 C T 7: 30,192,187 C144Y probably damaging Het
Ccdc17 G A 4: 116,598,797 V341I possibly damaging Het
Cd36 T C 5: 17,797,035 T323A probably damaging Het
Cdc14a CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG 3: 116,293,860 probably benign Het
Ckap2l G A 2: 129,269,241 Q679* probably null Het
Clec4g T A 8: 3,718,565 N93I probably benign Het
Cul9 A G 17: 46,530,100 M748T probably benign Het
Dnah11 A T 12: 118,186,976 I349N probably damaging Het
Dnajc14 T A 10: 128,806,391 Y61N probably benign Het
Dock6 A T 9: 21,802,506 Y1909* probably null Het
Dock8 T A 19: 25,188,375 D1874E probably benign Het
Dpm1 A G 2: 168,230,290 S22P probably benign Het
Dysf T C 6: 84,151,903 L1385P probably damaging Het
Egf T C 3: 129,697,772 T859A probably benign Het
Eif2b1 A T 5: 124,573,804 S162T probably benign Het
Emilin1 T C 5: 30,918,140 L575P probably damaging Het
Erp27 T A 6: 136,909,552 Q161L probably benign Het
Fbxw10 C A 11: 62,875,119 D738E possibly damaging Het
Fcgbp T G 7: 28,091,512 C733G probably damaging Het
Fgb T A 3: 83,049,815 probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Got1l1 G T 8: 27,198,475 Q283K probably benign Het
Grk2 G A 19: 4,290,843 R226C probably damaging Het
Hoxa10 T C 6: 52,234,354 D194G probably benign Het
Ipcef1 G A 10: 6,890,620 T363I probably damaging Het
Itga10 C A 3: 96,656,957 T922N probably damaging Het
Itgad T C 7: 128,178,380 I144T probably benign Het
Kat6b C A 14: 21,517,496 Q208K possibly damaging Het
Kidins220 T G 12: 25,038,384 L1042R probably damaging Het
Kmt2c T C 5: 25,281,357 S4733G probably damaging Het
Lrig3 A G 10: 126,014,867 I1101V probably benign Het
Lrp1 T A 10: 127,595,360 N311I probably damaging Het
Man2a1 A T 17: 64,651,315 K275I probably benign Het
Map3k10 T A 7: 27,665,009 N318I probably damaging Het
Map3k8 G A 18: 4,333,869 R408W probably damaging Het
Mast1 A G 8: 84,921,176 M523T probably damaging Het
Mast4 T C 13: 102,737,085 H1925R probably benign Het
Med12l C T 3: 59,076,786 S461L probably damaging Het
Mfap1a T C 2: 121,502,756 K65E probably damaging Het
Mical1 T C 10: 41,482,606 S507P probably benign Het
Miga2 T C 2: 30,378,388 V433A unknown Het
Mpdz T C 4: 81,356,416 T848A probably benign Het
Mycn A G 12: 12,939,777 V206A probably benign Het
Ndst1 G A 18: 60,705,148 Q342* probably null Het
Nectin1 A G 9: 43,791,072 M39V probably benign Het
Nectin4 A T 1: 171,382,641 R234* probably null Het
Ngb C G 12: 87,098,543 V113L possibly damaging Het
Nphp3 T A 9: 104,036,138 Y990N probably damaging Het
Nrd1 T C 4: 109,058,636 probably null Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr484 T A 7: 108,124,594 Y223F probably benign Het
Olfr714 A T 7: 107,074,532 K235* probably null Het
Osbpl6 A G 2: 76,585,259 Y655C probably damaging Het
Pcdhgb4 A G 18: 37,722,829 Q759R probably benign Het
Pcsk4 T C 10: 80,325,966 D164G probably damaging Het
Pde4d T A 13: 109,935,381 I303N probably damaging Het
Pdf T A 8: 107,048,340 M87L probably benign Het
Pigb A G 9: 73,034,558 S140P probably damaging Het
Plch1 T A 3: 63,851,128 probably benign Het
Plxna1 G T 6: 89,342,651 D557E probably benign Het
Polr2e C T 10: 80,036,958 V149M probably benign Het
Polr3a A T 14: 24,453,245 C1174S probably benign Het
Psmd2 T A 16: 20,655,619 S308R probably benign Het
Ptger1 T A 8: 83,669,373 V353E probably damaging Het
Ptprc A G 1: 138,068,373 M940T probably benign Het
Pus7l T C 15: 94,527,900 N540S probably damaging Het
Rap1gds1 T A 3: 139,050,556 I13L probably benign Het
Rasl10b A T 11: 83,412,764 N49I probably damaging Het
Rftn1 A T 17: 49,994,209 N537K probably benign Het
Rnase4 A G 14: 51,105,188 Y123C probably damaging Het
Rnf181 A C 6: 72,361,319 N26K probably benign Het
Rnf31 G A 14: 55,598,812 probably null Het
Rpusd3 C G 6: 113,416,239 C304S unknown Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 C A 2: 112,833,925 V1694L probably benign Het
Sephs2 T C 7: 127,273,174 D249G probably damaging Het
Serpina10 A G 12: 103,616,958 I409T probably damaging Het
Serpina5 C T 12: 104,103,144 A205V probably damaging Het
Sfr1 T A 19: 47,735,014 V319E probably damaging Het
Skil T A 3: 31,117,490 Y542N probably benign Het
Slc15a5 T C 6: 138,072,956 T154A probably benign Het
Slc27a2 T A 2: 126,587,926 L618Q probably damaging Het
Slc6a6 A T 6: 91,749,827 Y483F probably benign Het
Sprr1b T C 3: 92,437,136 I144M probably benign Het
Stat5a T A 11: 100,880,335 V580E Het
Tnk1 C T 11: 69,855,185 D305N probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Trav12-2 A G 14: 53,616,628 N20D probably benign Het
Trav16 T A 14: 53,743,589 N78K probably damaging Het
Trf C T 9: 103,226,931 A78T probably damaging Het
Ttn A G 2: 76,881,199 probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Vmn2r94 A T 17: 18,256,999 F383L probably benign Het
Vwa2 T C 19: 56,906,776 S461P probably benign Het
Zfp991 G A 4: 147,179,870 G568E probably damaging Het
Zfpl1 A G 19: 6,084,410 F15S probably damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTCCATCACAGCAGGCAAG -3'
(R):5'- ACATTGCCCAAGTTATCTGCAAAG -3'

Sequencing Primer
(F):5'- GACTGGTATTGCATGCTACAC -3'
(R):5'- GCCCAAGTTATCTGCAAAGTGACTG -3'
Posted On 2022-07-18