Incidental Mutation 'R9526:Dock8'
ID 719288
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9526 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24999529-25202432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25188375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1874 (D1874E)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: D1874E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: D1874E

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,609,098 Y372C probably damaging Het
4930412O13Rik A T 2: 9,882,823 T12S unknown Het
Actn1 A G 12: 80,183,619 L287S probably damaging Het
Adgrf1 A T 17: 43,305,346 Q292L possibly damaging Het
Arhgap32 A G 9: 32,260,730 D1602G probably benign Het
Atrnl1 C T 19: 57,629,119 P109S probably damaging Het
Camsap1 G A 2: 25,953,950 H230Y probably benign Het
Capns1 C T 7: 30,192,187 C144Y probably damaging Het
Ccdc17 G A 4: 116,598,797 V341I possibly damaging Het
Cd36 T C 5: 17,797,035 T323A probably damaging Het
Cdc14a CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG 3: 116,293,860 probably benign Het
Ckap2l G A 2: 129,269,241 Q679* probably null Het
Clec4g T A 8: 3,718,565 N93I probably benign Het
Cntnap2 T A 6: 46,015,231 L364Q probably damaging Het
Cul9 A G 17: 46,530,100 M748T probably benign Het
Dnah11 A T 12: 118,186,976 I349N probably damaging Het
Dnajc14 T A 10: 128,806,391 Y61N probably benign Het
Dock6 A T 9: 21,802,506 Y1909* probably null Het
Dpm1 A G 2: 168,230,290 S22P probably benign Het
Dysf T C 6: 84,151,903 L1385P probably damaging Het
Egf T C 3: 129,697,772 T859A probably benign Het
Eif2b1 A T 5: 124,573,804 S162T probably benign Het
Emilin1 T C 5: 30,918,140 L575P probably damaging Het
Erp27 T A 6: 136,909,552 Q161L probably benign Het
Fbxw10 C A 11: 62,875,119 D738E possibly damaging Het
Fcgbp T G 7: 28,091,512 C733G probably damaging Het
Fgb T A 3: 83,049,815 probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Got1l1 G T 8: 27,198,475 Q283K probably benign Het
Grk2 G A 19: 4,290,843 R226C probably damaging Het
Hoxa10 T C 6: 52,234,354 D194G probably benign Het
Ipcef1 G A 10: 6,890,620 T363I probably damaging Het
Itga10 C A 3: 96,656,957 T922N probably damaging Het
Itgad T C 7: 128,178,380 I144T probably benign Het
Kat6b C A 14: 21,517,496 Q208K possibly damaging Het
Kidins220 T G 12: 25,038,384 L1042R probably damaging Het
Kmt2c T C 5: 25,281,357 S4733G probably damaging Het
Lrig3 A G 10: 126,014,867 I1101V probably benign Het
Lrp1 T A 10: 127,595,360 N311I probably damaging Het
Man2a1 A T 17: 64,651,315 K275I probably benign Het
Map3k10 T A 7: 27,665,009 N318I probably damaging Het
Map3k8 G A 18: 4,333,869 R408W probably damaging Het
Mast1 A G 8: 84,921,176 M523T probably damaging Het
Mast4 T C 13: 102,737,085 H1925R probably benign Het
Med12l C T 3: 59,076,786 S461L probably damaging Het
Mfap1a T C 2: 121,502,756 K65E probably damaging Het
Mical1 T C 10: 41,482,606 S507P probably benign Het
Miga2 T C 2: 30,378,388 V433A unknown Het
Mpdz T C 4: 81,356,416 T848A probably benign Het
Mycn A G 12: 12,939,777 V206A probably benign Het
Ndst1 G A 18: 60,705,148 Q342* probably null Het
Nectin1 A G 9: 43,791,072 M39V probably benign Het
Nectin4 A T 1: 171,382,641 R234* probably null Het
Ngb C G 12: 87,098,543 V113L possibly damaging Het
Nphp3 T A 9: 104,036,138 Y990N probably damaging Het
Nrd1 T C 4: 109,058,636 probably null Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr484 T A 7: 108,124,594 Y223F probably benign Het
Olfr714 A T 7: 107,074,532 K235* probably null Het
Osbpl6 A G 2: 76,585,259 Y655C probably damaging Het
Pcdhgb4 A G 18: 37,722,829 Q759R probably benign Het
Pcsk4 T C 10: 80,325,966 D164G probably damaging Het
Pde4d T A 13: 109,935,381 I303N probably damaging Het
Pdf T A 8: 107,048,340 M87L probably benign Het
Pigb A G 9: 73,034,558 S140P probably damaging Het
Plch1 T A 3: 63,851,128 probably benign Het
Plxna1 G T 6: 89,342,651 D557E probably benign Het
Polr2e C T 10: 80,036,958 V149M probably benign Het
Polr3a A T 14: 24,453,245 C1174S probably benign Het
Psmd2 T A 16: 20,655,619 S308R probably benign Het
Ptger1 T A 8: 83,669,373 V353E probably damaging Het
Ptprc A G 1: 138,068,373 M940T probably benign Het
Pus7l T C 15: 94,527,900 N540S probably damaging Het
Rap1gds1 T A 3: 139,050,556 I13L probably benign Het
Rasl10b A T 11: 83,412,764 N49I probably damaging Het
Rftn1 A T 17: 49,994,209 N537K probably benign Het
Rnase4 A G 14: 51,105,188 Y123C probably damaging Het
Rnf181 A C 6: 72,361,319 N26K probably benign Het
Rnf31 G A 14: 55,598,812 probably null Het
Rpusd3 C G 6: 113,416,239 C304S unknown Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 C A 2: 112,833,925 V1694L probably benign Het
Sephs2 T C 7: 127,273,174 D249G probably damaging Het
Serpina10 A G 12: 103,616,958 I409T probably damaging Het
Serpina5 C T 12: 104,103,144 A205V probably damaging Het
Sfr1 T A 19: 47,735,014 V319E probably damaging Het
Skil T A 3: 31,117,490 Y542N probably benign Het
Slc15a5 T C 6: 138,072,956 T154A probably benign Het
Slc27a2 T A 2: 126,587,926 L618Q probably damaging Het
Slc6a6 A T 6: 91,749,827 Y483F probably benign Het
Sprr1b T C 3: 92,437,136 I144M probably benign Het
Stat5a T A 11: 100,880,335 V580E Het
Tnk1 C T 11: 69,855,185 D305N probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Trav12-2 A G 14: 53,616,628 N20D probably benign Het
Trav16 T A 14: 53,743,589 N78K probably damaging Het
Trf C T 9: 103,226,931 A78T probably damaging Het
Ttn A G 2: 76,881,199 probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Vmn2r94 A T 17: 18,256,999 F383L probably benign Het
Vwa2 T C 19: 56,906,776 S461P probably benign Het
Zfp991 G A 4: 147,179,870 G568E probably damaging Het
Zfpl1 A G 19: 6,084,410 F15S probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
Papilla UTSW 19 25078084 nonsense probably null
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
R8834:Dock8 UTSW 19 25163470 missense probably benign 0.16
R8991:Dock8 UTSW 19 25188367 missense possibly damaging 0.82
R9509:Dock8 UTSW 19 25095621 missense probably benign 0.00
R9622:Dock8 UTSW 19 25121181 missense probably null
R9634:Dock8 UTSW 19 25192221 missense probably damaging 1.00
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACAGGGCAGATTCTGAACTC -3'
(R):5'- TTTCTGGCTGACTCGGATCC -3'

Sequencing Primer
(F):5'- GGGCAGATTCTGAACTCCCTCC -3'
(R):5'- CTGACTCGGATCCTGGTCTTG -3'
Posted On 2022-07-18