Mutagenetix > Incidental Mutation

Incidental Mutation 'R9527:Aqr'

719296

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9527 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

113931642-114005788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 113932037 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1443 (S1443R)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably benign
Transcript: ENSMUST00000043160
AA Change: S1443R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: S1443R

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102543

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	A	G	2: 127,886,284 (GRCm39)	D453G	probably benign	Het
Atr	T	C	9: 95,767,429 (GRCm39)	M1162T	probably damaging	Het
Bicdl1	T	A	5: 115,811,188 (GRCm39)	N241I	possibly damaging	Het
Catip	A	G	1: 74,401,637 (GRCm39)	N38S	probably benign	Het
Cct6b	A	G	11: 82,630,447 (GRCm39)		probably null	Het
Clspn	A	T	4: 126,453,792 (GRCm39)	R72*	probably null	Het
Cntln	A	G	4: 84,892,120 (GRCm39)	Q335R	probably damaging	Het
Col9a2	T	C	4: 120,899,528 (GRCm39)		probably null	Het
Dip2c	A	G	13: 9,544,875 (GRCm39)	N55D	unknown	Het
Dnajc5b	A	T	3: 19,633,248 (GRCm39)	D157V	probably damaging	Het
Exoc6	T	G	19: 37,558,987 (GRCm39)	D86E	probably benign	Het
Fam204a	A	T	19: 60,208,992 (GRCm39)	H87Q	probably damaging	Het
Fer1l4	A	G	2: 155,871,617 (GRCm39)	W1388R	probably damaging	Het
Hcn2	A	T	10: 79,570,706 (GRCm39)	I642F	probably benign	Het
Igsf9	C	A	1: 172,323,244 (GRCm39)	L653M	probably damaging	Het
Imp4	A	G	1: 34,481,991 (GRCm39)	E38G	probably benign	Het
Kirrel1	C	A	3: 86,996,912 (GRCm39)	E297*	probably null	Het
Krt82	G	A	15: 101,454,558 (GRCm39)	T222I	probably benign	Het
Lysmd1	T	C	3: 95,042,156 (GRCm39)	L10P	probably benign	Het
Mcmbp	A	G	7: 128,305,242 (GRCm39)	S509P	probably damaging	Het
Mms19	A	T	19: 41,952,830 (GRCm39)	I93N	possibly damaging	Het
Mtmr7	A	G	8: 41,011,345 (GRCm39)	F402L	possibly damaging	Het
Myo1h	C	T	5: 114,453,098 (GRCm39)	R49C		Het
Scd3	T	C	19: 44,226,816 (GRCm39)	Y217H	probably benign	Het
Snx17	T	C	5: 31,353,826 (GRCm39)	Y205H	probably damaging	Het
Spag17	T	A	3: 99,970,777 (GRCm39)	D1320E	probably damaging	Het
Tasor2	A	T	13: 3,635,191 (GRCm39)	S539T	possibly damaging	Het
Xirp1	C	A	9: 119,847,558 (GRCm39)	V442L	probably damaging	Het
Xrcc5	G	A	1: 72,369,091 (GRCm39)	R315H	probably damaging	Het
Yju2b	A	T	8: 84,989,652 (GRCm39)	C56S	probably damaging	Het
Zc3hav1	C	A	6: 38,330,913 (GRCm39)	C82F	probably damaging	Het
Zfp787	A	G	7: 6,136,027 (GRCm39)	F75L	probably damaging	Het
Zswim3	C	T	2: 164,662,285 (GRCm39)	T255I	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	113,956,423 (GRCm39)	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	113,982,006 (GRCm39)	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	113,950,508 (GRCm39)	nonsense	probably null
IGL02297:Aqr	APN	2	113,980,962 (GRCm39)	missense	probably benign	0.24
IGL02380:Aqr	APN	2	113,940,417 (GRCm39)	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	113,967,398 (GRCm39)	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	113,949,261 (GRCm39)	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	113,943,127 (GRCm39)	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	113,943,835 (GRCm39)	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	113,965,305 (GRCm39)	splice site	probably benign
IGL03001:Aqr	APN	2	113,977,400 (GRCm39)	missense	probably benign
IGL03092:Aqr	APN	2	113,989,424 (GRCm39)	missense	probably benign	0.38
IGL03222:Aqr	APN	2	113,951,737 (GRCm39)	missense	probably damaging	1.00
capricorn	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
Goat	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
Pliades	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
sagittarius	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
Zodiac	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	113,961,215 (GRCm39)	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	113,989,491 (GRCm39)	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114,000,533 (GRCm39)	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	113,988,085 (GRCm39)	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	113,961,092 (GRCm39)	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	113,961,085 (GRCm39)	missense	probably benign	0.00
R0685:Aqr	UTSW	2	113,971,458 (GRCm39)	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	113,947,136 (GRCm39)	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	113,980,890 (GRCm39)	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	113,992,133 (GRCm39)	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	113,967,485 (GRCm39)	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	113,961,015 (GRCm39)	critical splice donor site	probably null
R2377:Aqr	UTSW	2	113,971,421 (GRCm39)	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	113,967,398 (GRCm39)	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R3715:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R4586:Aqr	UTSW	2	113,943,058 (GRCm39)	missense	probably benign	0.06
R4663:Aqr	UTSW	2	113,992,147 (GRCm39)	nonsense	probably null
R4809:Aqr	UTSW	2	114,005,695 (GRCm39)	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	113,940,418 (GRCm39)	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	113,943,832 (GRCm39)	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114,000,506 (GRCm39)	critical splice donor site	probably null
R5050:Aqr	UTSW	2	113,943,090 (GRCm39)	nonsense	probably null
R5213:Aqr	UTSW	2	113,943,808 (GRCm39)	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	113,947,059 (GRCm39)	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	113,979,515 (GRCm39)	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	113,986,746 (GRCm39)	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	113,957,442 (GRCm39)	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	113,973,530 (GRCm39)	nonsense	probably null
R6015:Aqr	UTSW	2	114,005,646 (GRCm39)	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	113,986,758 (GRCm39)	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	113,940,445 (GRCm39)	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	113,979,477 (GRCm39)	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	113,947,052 (GRCm39)	nonsense	probably null
R7211:Aqr	UTSW	2	113,965,204 (GRCm39)	missense	probably benign	0.01
R7232:Aqr	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	113,934,543 (GRCm39)	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	113,950,427 (GRCm39)	nonsense	probably null
R7490:Aqr	UTSW	2	113,989,349 (GRCm39)	critical splice donor site	probably null
R7526:Aqr	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	113,945,074 (GRCm39)	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	113,992,161 (GRCm39)	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	113,943,806 (GRCm39)	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	113,949,358 (GRCm39)	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	113,967,474 (GRCm39)	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	113,934,528 (GRCm39)	missense	probably benign	0.04
R9664:Aqr	UTSW	2	113,971,396 (GRCm39)	nonsense	probably null
Z1176:Aqr	UTSW	2	113,940,472 (GRCm39)	missense	probably benign	0.25
Z1176:Aqr	UTSW	2	113,938,603 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCATAAGTACTGAAATTAGCTGGTG -3'
(R):5'- TATGAGAGCCTGATCAGCTTCG -3'

Sequencing Primer
(F):5'- AGCTGGTGTTATTAAAGTCATACAG -3'
(R):5'- CGAGAGCCAGTGTTCTTGACTC -3'

Posted On

2022-07-18